Concept explainers
To analyze:
The amino acid sequence of a segment of a polypeptide is
a. Describe the mRNA order encoding this polypeptide fragment? Use N to denote any
b. Determine the DNA template and coding strand orders corresponding to mRNA. Use the N, Pu, and Py signs as placeholders.
Introduction:
Genetic information of DNA is encoded in a tri-nucleotide code known as codons. Codons have specific characteristics- all the codons specify amino acids; there is one start codon and three stop codons also known as nonsense codons. The beginning and ending of the translation process requires specific codons. The Codons are present on mRNA and are read during translation from
Want to see the full answer?
Check out a sample textbook solutionChapter 9 Solutions
GENETIC ANALYSIS: INTEGRATED - ACCESS
- A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)arrow_forwardUsing the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAUarrow_forwardGiven the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)arrow_forward
- For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acidarrow_forwardFor the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG Garrow_forwardThe DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'arrow_forward
- For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference. 5' AGUCCGUAC 3' 5' AAUUGCUUC 3'arrow_forwardConsider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5'-GCAAGUCUUAAU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. ala-ser-leu-asn 2. If mutation occurs by substitution of the 6th nucleotide with adenosine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and non-sense.arrow_forwardDraw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphatearrow_forward
- Help me pleasearrow_forwardThe sequence of a polypeptide is determined by the order of codons that specify the amino acids in the polypeptide. How many different sequences of codons can specify the polypeptide sequence methionine-histidine-lysine? (Use the table to find the number of possibilities.) SECOND BASE UAU UACFTyrosine (Tyr) UAA -Stop codon UAG -Stop codon UUUL UGU Cysteine (Cys) UCU uc UCA FSerine (Ser) uca Uuc Phenylalanine (Phe) UUAL Leucine (Leu) CAU CAC CAA Glutamine (Gin) CAGF UGA -Stop codon uaa -Tryptophan (Trp) CGU сос CGA FArginine (Arg) CU CU Histidine (His) CuA FLeucine (Leu) Cua) Proline (Pro) CCA cca AAU Asparagine (Asn) AGU Serine (Ser) AGC AUU ACU ACC Threonine (Thr) AACF AAA AAGLysine (Lys) AUC Fisoleucine (lle) AUA Methionine (Met) AUG - Start codon ACA ACG AGA AGGFArginine (Arg) GU GACAspartic acid (Asp) GGA GAA Glutamic acid (Glu) Gaa) GcU -Valine (Val) G GUA GCA FAlanine (Ala) Glycine (Gly) 8. 1 4 THIRD BASE 2. FIRST BASEarrow_forwardWhat amino acid would a tRNA with anticodon CUA carry? Enter the 3 letter code only [A]. [e.g. Met for anticodon UAC]arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning