GEN COMBO LOOSELEAF MICROBIOLOGY:A SYSTEMS APPROACH; CONNECT ACCESS CARD
5th Edition
ISBN: 9781260149364
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 2CTQ
On paper, replicate the following segment of DNA:
5′ A T C G G C T A C G T T C A C 3′
3′ T A G C C G A T G C A A G T G 5′
- a. Show the direction of replication of the new strands and indicate the location of the lagging and leading strands.
- b. Explain one challenge in the replication of circular DNA and in the replication of linear DNA and how each is resolved in a cell.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A. DNA Replication
Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the
parent DNA (3' to 5') strand correspond to a start codon and its last three
nucleotides correspond to a stop codon in its MRNA counterpart later on.) Write it
down as follows:
a. the sequence of parent DNA (template)
3'
A C
A TT 5'
3'
Upon undergoing DNA replication, show what one daughter DNA molecule will look
like. Write it down as follows:
b. the sequence of DNA Daughter 1:
3'
5'
5'
3'
C. the sequence of DNA Daughter 2:
3'
3'
5'
in
in
Which of the following statements are true regarding the properties of DNA and RNA polymerase. Select all that apply.
Both DNA and RNA polymerase synthesize nucleic acid strands in the 5" to 3' direction.
Both DNA and RNA polymerase can initiate strand synthesis on their own.
I.
RNA polymerase initiates strand synthesis, while DNA polymerase depends upon an existing strand to continue synthesis.
II.
RNA polymerase only uses ribonucleotides for strand synthesis.
DNA polymerase only uses deoxyribonucleotides for strand synthesis.
V.
Au DNA and RNA polymerases from eukaryotes behave very differently from DNA and RNA polymerases found in prokaryotes.
O VI.
Explain the effect(s) the following scenarios would have on DNA replication or translation. For each scenario, state whether DNA replication or translation would be able to proceed and explain your reasoning.
Low amount of 7- methyl guanosine in the nucleus
low amount of DNA polymerase I
lack of helicase
Chapter 9 Solutions
GEN COMBO LOOSELEAF MICROBIOLOGY:A SYSTEMS APPROACH; CONNECT ACCESS CARD
Ch. 9.1 - Define the terms genome and gene.Ch. 9.1 - Differentiate between genotype and phenotype.Ch. 9.1 - Diagram a segment of DNA, labeling all important...Ch. 9.1 - Summarize the steps of bacterial DNA replication...Ch. 9.1 - Compare and contrast the synthesis of leading and...Ch. 9.2 - Explain how the classical view of the central...Ch. 9.2 - Prob. 7AYPCh. 9.2 - Illustrate the steps of transcription, noting the...Ch. 9.2 - Prob. 9AYPCh. 9.2 - Prob. 10AYP
Ch. 9.2 - Identify the locations of the promoter, the start...Ch. 9.2 - Prob. 12AYPCh. 9.2 - Prob. 13AYPCh. 9.3 - Define the term operon and explain one advantage...Ch. 9.3 - Differentiate between repressive and inducible...Ch. 9.3 - Prob. 16AYPCh. 9.4 - Explain the defining characteristics of a...Ch. 9.4 - Describe three forms of horizontal gene transfer...Ch. 9.5 - Prob. 19AYPCh. 9.5 - Prob. 20AYPCh. 9 - What is the smallest unit of heredity? a....Ch. 9 - The nitrogen bases in DNA are bonded to the a....Ch. 9 - DNA replication is semiconservative because the...Ch. 9 - In DNA, adenine is the complementary base for...Ch. 9 - Transfer RNA is the molecule that a. contributes...Ch. 9 - Prob. 6MCQCh. 9 - The lac operon is usually in the _____ position...Ch. 9 - Prob. 8MCQCh. 9 - Prob. 9MCQCh. 9 - When genes are turned on differently under...Ch. 9 - The DNA pairs are held together primarily by...Ch. 9 - Prob. 12TFCh. 9 - Prob. 13TFCh. 9 - Prob. 14TFCh. 9 - Prob. 15TFCh. 9 - Explain the relationship among the following...Ch. 9 - On paper, replicate the following segment of DNA:...Ch. 9 - Provide evidence in support of or refuting the...Ch. 9 - Using the DNA sequence 3 TAC CAG ATA CAC TCC CCT...Ch. 9 - Use your knowledge of DNA recombination events to...Ch. 9 - Prob. 1VCCh. 9 - From chapter 4, figure 4.11a. Speculate on why...Ch. 9 - Concept Mapping | Blooms Level 6: Create Appendix...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How do you complete this table?arrow_forwardDescribe DNA replication. What are Okazaki fragments? Why does each chromosome have thousands of replication start sites instead of just one?arrow_forwardDescribe the function of DNA polymerase. Explain why each part of the name DNA polymerase (DNA, polymer, -ase) makes sense.arrow_forward
- a. What process would be unaffected in with defective topoisomerase? Prokaryotic DNA packaging Eukaryotic DNA packaging Prokaryotic DNA replication Eukaryotic DNA replication All of the above rely on topoisomerase function b. Why is primase required for DNA replication? To unwind the DNA helix To prime nucleotides for addition to the growing chain To provide a 3' OH for DNA polymerase To recognize the origin of replication To remove supercoils ahead of the replication machinery C. What is the purpose of PCR reaction? To alter the sequence of a fragment of DNA. To insert a fragment of DNA into a bacterium To amplify a fragment of ONA To destroy a fragment of DNA To determine the sequence of nucleotides in a fragment of DNA.arrow_forwardBelow is a diagram of DNA replication as currently believed to occur in E. coli. From specific points, arrows are provided that lead to numbers. Answer the questions below relating to the locations specified by the numbers. (02) What end (5’ or 3’) of the molecule is here? (State which) What enzyme is probably functioning here to deal with supercoils in the DNA? What enzyme is probably functioning here to unwind the DNA? What nucleic acid is probably depicted here? What are these short DNA fragments usually called? What enzyme probably functions here to couple these two newly synthesized fragments of DNA? Is this strand the leading or lagging strand? What end (5’ or 3’) of the molecule is here? (State which)arrow_forwarda. As a result of the structure of DNA and RNA, replication, transcription and translation are possible. What can nucleic acids do, as a result of their structure, that enables these processes to occur? The figure below shows a simplified schematic representation of a segment of DNA. The DNA is labelled with the numbers 1 – 14 for easy reference. -35 sequence Pribnow box 5' UTR 3' UTR DNA TTGACA TATAAT -35 -10 Gene a Gene B Gene y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 UTR = untranslated region b. At which position on the DNA (number 1 - 14) will transcription be initiated? c. At which position on the DNA (number 1 - 14) will the first signal for translation be found? d. Between which two regions on the DNA will the polyadenylation signal be found? Use the numbers to indicate the region. e. Between which two regions on the DNA will the first Shine-Dalgarno / Ribosome Binding Sequence be found? Use the numbers to indicate the region.arrow_forward
- Consider the proteins involved in DNA replication. A. What can a regular DNA polymerase do? Choose one or more. i Catalyze formation of a phosphodiester bond between one dNTP and another dNTP ii Catalyze formation of a phosphodiester bond between one DNA fragment and another iii Catalyze formation of a phosphodiester bond between the 3' end of a DNA fragment, and a dNTP iv Catalyze formation of a phosphodiester bond between the 5' end of a fragment and a dNTP o Open up double-stranded DNA to expose the two separate template strands B. For any ONE action DNA polymerase canNOT do, from the list above, name an enzyme that does that action or makes it unnecessary. Enzyme: What action it does, or makes unnecessary (by numbers given above in part a): i ==>> iv Varrow_forwardUse the picture to solve for the following.arrow_forwardA. Diagram a short single strand of DNA 5’ -AA-GG- 3’. Show the chemical structure of the phosphoribosyl backbone and the attachment point for nucleotides added as “A” or “G”. B. Diagram the product of digestion was a restriction enzyme to cut this sequence between the A and G.arrow_forward
- Below is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA CTAAAGCTTCGGGCATTATCG 3' GATTTCGAAGCCCGTAATAGC TATCGACS Consider the following primer which binds to the DNA replication bubble on the diagram above: 5'-GCUAUCG-3' Identify the DNA sequence to which this primer would bind and the orientation. If the replication fork moves to the right, will the primer be used to create the leading strand of replication or the lagging strand? Explain your answer b. If the replication fork moves to the left, will the primer be used to create the leading strand of replication or a. the lagging strand? Explain your answer. What would the next five nucleotides added to the primer by DNA polymerase? С.arrow_forwardFrom standpoint of replication and transcription, explain how RNA polymerase is allowed to incorporate the first nucleotide whereas DNA polymerase needs a primer. Explain how this difference impacts the process of replication and transcription.arrow_forwardBelow is a diagram of DNA replication as currently believed to occur in E. coli. Arrows start from numbers and end at specific points. Answer the questions relating to the locations specified by the numbers (1) Which end (5' or 3') of the molecule is here? (2) Which enzyme is probably functioning here to deal with supercoils in the DNA? (3) Which enzyme is probably functioning here to unwind the DNA?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY