Biology: The Unity and Diversity of Life (MindTap Course List)
15th Edition
ISBN: 9781337408332
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9, Problem 2SQ
A binding .site for RNA polymerase is called a ___ .
- a. gene
- b. promoter
- c. codon
- d. protein
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
CG Islands in DNA are important for :-
A) Methylation
B) Acetylation
C) t- RNA synthesis
D) DNA replication
Part A) In your own words describe what happens in transcription and translation
Include which types of nucleic acids are involved in each step
Describe the function of each type of nucleic acid in the process of making proteins
Part B) Also, explain how two nucleic acids "recognize" or "talk" to each other
The anticodon of a particular tRNA molecule is(A) complementary to the corresponding mRNA codon.(B) complementary to the corresponding triplet in rRNA.(C) the part of tRNA that bonds to a specific amino acid.(D) catalytic, making the tRNA a ribozyme.
Chapter 9 Solutions
Biology: The Unity and Diversity of Life (MindTap Course List)
Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - A chromosome contains many different genes that...Ch. 9 - A binding .site for RNA polymerase is called a ___...Ch. 9 - In cells, most RNA molecules are ___ ; most DNA...Ch. 9 - Prob. 4SQCh. 9 - The main function of a DNA molecule is to ________...Ch. 9 - The main function of an mRNA molecule is to ___ ....
Ch. 9 - Prob. 7SQCh. 9 - Prob. 8SQCh. 9 - Prob. 9SQCh. 9 - Anticodons pair with ___ . a. mRNA codons b. DNA...Ch. 9 - Prob. 11SQCh. 9 - Prob. 12SQCh. 9 - Prob. 13SQCh. 9 - Energy that drives translation is provided mainly...Ch. 9 - Match the terms with the best description. ______...Ch. 9 - Researchers are designing and testing antisense...Ch. 9 - An anticodon has the sequence GCG. What amino acid...Ch. 9 - Each position of a codon can be occupied by one of...Ch. 9 - Prob. 4CTCh. 9 - Translate the .sequence of bases in the previous...Ch. 9 - Can you .spell your name (or someone else's) using...Ch. 9 - Bacteria use the.same stop codons as eukaryotes....
Additional Science Textbook Solutions
Find more solutions based on key concepts
11. In the early 1800s, French naturalist Jean Baptiste Lamarck suggested that the best explanation for the rel...
Campbell Biology: Concepts & Connections (9th Edition)
Figure 11.6 Label the features of the skin.
Laboratory Manual For Human Anatomy & Physiology
Identify each of the following reproductive barriers as prezygotic or postzygotic. a. One lilac species lives o...
Campbell Essential Biology with Physiology (6th Edition)
Match the people in column A to their contribution toward the advancement of microbiology, in column B. Column ...
Microbiology: An Introduction
What were the major microbiological interests of Martinus Beijerinck and Sergei Winogradsky? It can be said tha...
Brock Biology of Microorganisms (15th Edition)
Relative thickness of the myocardium in different chambers; the functional significance of those differences; a...
Anatomy & Physiology: The Unity of Form and Function
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- "Removing introns from pre-mRNA can result in different gene variants”- Briefly explain this statement at your own words.arrow_forwardANSWER THIS; Click Edit DNA and make a substitution mutation that changes the first base (C) in the second codon to an A. Ø What effect does this mutation have on the polypeptide? Compare to the original polypeptide. arrow_forwardUse this genetic code table for some of the questions ahead. You do not need to memorize the code, except for the start codon (AUG = Met) and the stop codons (UAA, UAG, UGA). Which of the following statements about the genetic code is correct? A) All codons specify more than one amino acid. B) The genetic code is redundant. C) All amino acids are specified by more than one codon. D) All codons specify an amino acid.arrow_forward
- Please answer fast Give ans for each statement 1.A protein linked to a disease state is being studied by scientists. They discover that the disease protein has the same amino acid sequence as the protein in healthy people. State right or wrong: Does the following explanation provide a plausible biological explanation for the disease state? a.The RNA polymerase does not correctly read the codon code on the mRNA. b.The protein is not being regulated properly. c.The disease protein is incorrectly folded. d. The disease protein lacks a post-translational modification. e.The protein amounts differ because they are expressed differently.arrow_forwardDNAT A C C G C T C C G C C G T C G A C A A T A C C A C T mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______arrow_forwardPlease answer fast A.Process 1 is B.Process 2 is C.If the bottom strand of the DNA (sequence not shown) is the template, the RNA sequence, 5' to 3' is D.If the bottom strand of the DNA is the template, the protein amino acid sequence from the RNA is E.If the bottom strand of the DNA is the template, the tRNA anticodon sequence left to right 5' to 3', for the first RNA codon isarrow_forward
- RNA can function: please explain your answer a.A) as a non-permanent template to synthesize protein b.B) to recruit the correct amino acid during translation c.C) as part of ribosomes to synthesize protein d.D) to help initiate DNA synthesis during replication e.Only A and C Only A, B and C A, B, C and Darrow_forwardWhich of these molecules would have the most monomers (i.e. be longest)? a) RNA polymer that comprises the transfer RNA b) mRNA transcript just after transcription c) polypeptide chain released by ribosome d) mRNA transcript that a ribosome attaches toarrow_forwardA single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.arrow_forward
- During the transcription of DNA to mRNA, __________. Group of answer choices a) RNA polymerase moves along the DNA (reads) in the 5’ to the 3’ direction b) the 3’ end of the mRNA molecule is produced first c) RNA polymerase must first bind to a promoter sequence d) transcription is initiated at a “start codon”arrow_forwardExamining the DNA of a cancerous cell, a scientist would find strong expression of A. siRNAs. B. rRNAs. C. oncogenes. D. transcription factors.arrow_forwardThe anticodons are located in a.tRNA. b.rRNA. c.mRNA. d.ribosomes. e.endoplasmic reticulum.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY