Screen Shot 2023-10-28 at 8

please help with practice problems

True or False: 1. The 6X HIS tag is required for a eukaryotic protein to be expressed in E. coli 2. BAC vectors are an appropriate choice for cloning cDNAs 3. Cluster analysis of micro-array data groups together mRNAs of similar sequence 4. In genomic DNA, on average EcoR1 restriction sites are more common than Mse1 restriction sites 5. Tags such as HA that are fused to proteins always compromise their function.

Need solution urgently

Need short amswer only

B only

answer c only

X-gal is used to help with what we call “blue/white screening.” X-gal is a substrate that the enzyme beta-galactosidase can convert to blue color. When transformation reactions are plated on LB plates with (amp and) X-gal, if an insert was not cloned into the SmaI-site of pUC19, the bacteria will be blue. If an insert was cloned into the SmaI-site of pUC19, the bacteria will be white. Based on the information in this question, and shown in Figure 1 below, can you explain why we are hoping to obtain white colonies? (Please explain both why blue colonies lack a cloned insert, and why white colonies possess a cloned insert.) Fig. 1.  Restriction map of pUC19 (2686 bp).  Image obtained from the New England Biolabs e-catalog (https://www.neb.com/products/n3041-puc19 vector#Product%20Information_Properties%20&%20Usage).  Note the presence of the lacZa gene, and note that the SmaI site (nt 412) into which (ideally) your insert was ligated is found within the lacZ ORF.  Enzymes in the…

show your rationale   How many RT-PCR products generated from 13 copies of mRNA (= cDNA) from 33 PCR amplification cycles?   What was the original starting number of mRNA molecules if after 36 PCR cycles, the reaction had generated 996,432,412,672 copies?

Please help me with this question within an hour???? with a proper explaination ASAP

help

Sal1 Xho1 Insert pUC cloning vector MCS Insert Digested with Sal1 on the left and Xho1 on the right Sal1 Ori Vector Digested with Sal1 Xho1: СТСGAG Sal1: GTCGAC RE cut site Part B) After 8 h of sleep, you realize your mistake above (Question 3 Part A), and you successfully transformed your plasmid and obtained a subset of white colonies and blue colonies on the plate. Question: You conclude that all the blue colonies contain a plasmid O With the insert in the LacZ screening marker With the insert in the Antibiotic selectable marker O Without an insert in the LacZ screening marker O None of the above + Lacz alpha AmpR

Once cloning is complete, a recombinant OXA-M290 protein can be produced in E. coli. Competent E. coli BL21(DE3) cells are transformed with the pET-28a-OXA-M290 plasmid, and the transformed cells are grown on an agar plate that contains kanamycin.  The E. coli BL21(DE3) cells transformed with the pET-28a-OXA-M290 vector are next grown in liquid growth media that contains kanamycin. Once the culture reaches an OD600 of 0.6, isopropyl β-D-1-thiogalactopyranoside (IPTG) is added to a final concentration of 0.5 mM to induce protein production.   How does the addition of IPTG result in the transcription of genes that are regulated by the T7 promoter in E. coli BL21(DE3) cells? [4 – 6 sentences suggested] For Context ONLY: For this biology course and based on the results obtained from a previous BLAST search, the bacteria responsible for the infection at a Hospital is most likely a new strain of Escherichia coli. This strain is given the name E. coli AFB.  Earlier, BLAST was used to study a…

For a molecular cloning experiment using the bacterial strain E. coli K12 is used to insert the gene rspL with pUC19. The first attempt utilized the restriction enzyme BamHI which did not produce any transformations. The second attempt utilized the restriction enzymes BamHI and EcoRI. Why was BamHI used first and what difference did the EcoRI do?

In Figure 5-38, precisely which gene is eventually identified from the genome sequence?

Primers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAA

Transforming an Animal In order to create the transgenic cow, your lab first needs to create a DNA vector containing the insulin gene. This step involves a considerable amount of scientific terminology. Make sure you understand the meaning of key terms. Match the following terms with their correct definitions. | ampicillin resistance gene 5 restriction site 6 Origin of replication 7 Ligase 2 promoter 3 Xhol Ч ехоn is a region of DNA that is not transcribed. is the location in the plasmid that is recognized by the restriction enzyme Xhol. is an enzyme that joins DNA fragments together. is the location on the plasmid where DNA replication begins. is a region of DNA that initiates transcription of a gene. is an restriction enzyme that looks for the sequence TCGA. is a gene that enables you to identify bacterial cells that have taken up the plasmid.

.

Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their sequence and explain why. Tip: The plasmid map is showed below, details of restriction site sequences can be found at https://enzymefinder.neb.com/#!#nebheader

Please answer both

Table 1 shows a list of restriction endonucleases with their recognition sequence and the sites of cleavage indicated by arrows. Table 1 Enzyme name Recognition sequence and position of cut 5'GIAATTC3 5'G!GATCC3' 5'GIGTACC3 5'GCIGGCCGC3' 5'IGATC3' 5'GGTACIC3' 5'ALGATCT3 EcoRI ВатHI Аcс651 Notl Sau3A Kpnl BglII (i) Which restriction enzyme(s) produce blunt ends? (ii) Are there any pair of neoschizomers in the list? Explain. (iii) Are there any pair of isocaudomers in the list? Explain.

Several DNA coding for different proteins, CRISPR, or siRNAs against different genes were expressed in cultured normal human somatic cells (A–G; “-” = control: no expression of exogenous gene/siRNA). The cells were either untreated (-) or irradiated to induce DNA damage (+). After 24 hours, the cells were harvested for preparing cell-free extracts. Different proteins were then detected using SDS-PAGE followed by Western blotting. These include p53, the phosphorylated form of pRb as well as total pRb, the phosphorylated form of lamin B as well as total lamin B, and caspase 3 (note that the darkness of the bands roughly corresponds to the intensity of the bands in the Western blot). Fig.1. The cells were also analysed using flow cytometry. The x-axis is DNA contents (2N represents the position of DNA as in G1 phase; 4N represents the position of DNA as in G2/M phase); the y-axis is the accumulated cell number. Fig.2. (1) The first four samples are known (the rest, see below, are all…

In biotechnology, gene cloning is a crucial technique used in many genetic modification experiments. A vector is normally required to perform this process. The vector commonly used to transform a bacterial host cell is known as a plasmid. Below is the general plasmid map of pBR322. Elaborate the functions of ori, Ap and TeR present in pBR322. Bul 3759 Prul 3733 PM 3507 BDI 3602 Asel 3537 Bal 3433 Finci 3905 Scal 3844 3787 Bad 3420 Ahdi 3361 Acul 3000 AlwNI 2884 Sspl 4168 Earl 4155 Acul 4048 Xust 3961 Bell 2777 Bc1 2682 ori Aall-Zeal 4284 BeiVI 4209 B 4205 Del 2575 Pail-Att 2473 BAB 2404 EcoRI 4350 Earl 2351 BspQI-Sapl 2350 Ndel 2295 BAP 2291 178-Accl 2244 Cial-Ispit 23 Hindill 29 pBR322 4,361 bp Ball 2225 TthJ11- Part 2217 rop EcoRY 185 Bmtl-Nhel 229 Hamill 375 Sgr 400 Ball 471 Xml 2029 Pull 2064 Dalt 2162 BamB 2122 Banil 485 Bigl 128 Sphl 582 EcoN1 822 Sall-Accl-Hell 651 Pshu 712 BsaBl 1668 Engl 939 BeY1 945 Nrul 972 BAPT 1045 BspMI-BfuM 1063 PAMI 1315 Bumi 1353 Bgl 1650 BapEl 1664…

You have isolated a cDNA clone encoding a protein of interest in a higher eukaryote. This cDNA clone is not cleaved by restriction endonuclease EcoRI. When this cDNA is used as a radioactive probe for blot hybridization analysis of EcoRI-digested genomic DNA, three radioactive bands are seen on the resulting Southern blot. Does this result indicate that the genome of the eukaryote in question contains three copies of the gene encoding the protein of interest? Explain.

Bacteriophage lambda is as one of the routinely used molecular cloning vectors, which alsoserved as a model system for the study of bacteriophage morphogenesis, DNA replication, andgene regulation. (a)Blunt-end cloning is proven to be more challenging, compared to sticky-end cloning.Illustrate ONE (1) approach that can be conducted in order to perform blunt-end cloning ofa PCR product to a plasmid vector.d) Evaluate the advantages of mRNA as a source material for generating DNA fragments, inrelation to gene cloning.e) E. coli, in most cases is not a suitable host for cloning genes from eukaryotes. Discuss thisstatement.

As a part of undergrad lab project, you have to clone Your Favorite Gene into plasmid cloning vector (4740 bp) pUC18. Restriction maps for both YFG and cloning vector are provided. The plasmid has a bacterial origin of replication (ori), an ampicillin resistance gene (AmpR) that degrades ampicillin antibiotic. It also has LacZ gene that encodes the β-gal enzyme, which converts white X-gal substrate into a blue product. pLac is a bacterial promoter. Restriction Enzyme Recognition Site : A slash (/) represents the cut site for each restriction enzyme. Enzyme 1 5’- G/TCGA C -3’ 3’- C AGCT/G-5’  Enzyme 2 5’-C/TCGA G-3’ 3’G AGCT/ C5’ Enzyme 3 5’- GTC / GAC- 3’ 3’- CAG / CTG- 5’ Enzyme 4 5’-C AATT /G-3’ 3’-G/ TTAA C-5’  Enzyme 5 5’C AATT/G-3’ 3’G/TTAA C-5’ Enzyme 6 5’G/GATC C-3’ 3’C CTAG/ G-5’   Enzyme 7 5’G/GATC C-3’ 3’C CTAG/ G-5’ 1a) The table below shows restriction enzyme pairs used by various teams to digest the YFG and clone it in the…

The cellulase gene of Bacillus licheniformis was successfully cloned into the pET21a vector and expressed in Escherichia coli BL21. The pET21a vector consists of ampicillin resistant gene. To screen for the successful transformants, E. coli BL21 was cultivated on LB agar containing ampicillin (100 pg/mL) and 0.5% (w/v) carboxymethylcellulose, and incubated at 37 0C for 6 hours. After that the agar plate was stained with Congo red solution for 15 minutes and washed twice with sodium chloride solution and the observation is as shown in Figure 3.   Answer the following: (i.) Briefly explain why ampicillin was added to the LB agar.          (ii) Indicate the function of carboxymethylcellulose in the LB agar. (iii) Conclude how the researchers were able to identify the E. coli BL21 that carried the cellulase gene.

Could you explain how you would know if you successfully induced transformation? Thank you Did you successfully demonstrate transformation occurred? Why or why not? (How do I know, what do I look for?) Explain the control used in this experiment. What was it, and why was it necessary?  Based on the calculation in the question above, comment on the relative difficulty of achieving successful transformation of E. coli. (Please explain the relative difficulty)

Materials In order to determine the genetic material of a T2 phage, Alfred Hershey and Martha Chase conducted experiments using T2 phages that infected bacteria. In one treatment, they grew phages with radioactive sulfur. In another treatment, they grew phages with radioactive phosphorous. They allowed both types of phages to infect bacterial cells. After infection, they found that only bacteria infected with phages grown with radioactive phosphorous showed any radioactivity. Why did they use radioactive sulfur and phosphorous for this Updates Grades Members O Conferences DBQ Online experiment? * Newsela ormation O Sulfur is part of the DNA molecule but not part of a protein molecule. Biology Periods 1 and 2 Sulfur and phosphorous are some of the most reactive molecules and are easily ding periods school MP1, Highschool Highschool MP3, school MP4 traced. Sulfur and phosphorous are able to survive the centrifuge, a crucial component of the experiment. ion Phosphorous is part of the DNA…

You are working for a pharmaceutical company are are tasked with creating E. Coli that express an influenza antigen (a protein that is recognized by our immune system) fortreatment of the influenza virus. The cDNA of the antigen is available in a carrier vector(pCARRY) that contains a kanamycin resistance gene as shown on the left below. Inorder to get E. Coli to express the antigen, you need to clone the gene for the influenzaantigen into an expression vector that contains an E. Coli-specific promoter. You obtain such an expression vector, which contains an ampicillin resistance gene as shown on the right below (pBACTERIA)  a. An end generated by digestion with BamH1 can be ligated to an end generated by digestion with BlgII. Why is this possible? b. To clone the gene for the influenza antigen from pCARRY into pBACTERIA plasmid:i. What restriction enzyme should you use to digest pCARRY? ii. What restriction enzyme should you use to digest pBACTERIA? c. After you ligate the products of…

Pls help ASAP