IMG_6327

GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.

I want clear handwritten solution of all parts ...i will up vote

I only need letter D and E

Do question 26 using the provided image

new class of cholesterol-lowering treatments that utilize small interfering RNAs (siRNAs) are currently in clinical trials. These work by binding to and degrading specific mRNAs that encode apolipoproteins (O'Donoghue et al., 2022). Which specific cells do these siRNAs have to be directed to in order to be effective? O adipose cells O hepatocytes macrophages pancreatic beta cells

40

1. Describe the process by which an integral membrane glycoprotein goes from mRNA to being an integral membrane protein 2. Describe in detail the initiation of translation in eukaryotes versus prokaryotes. All steps. 3. Compare and contrast gated transport and transmembrane transport of mitochondria. Specific details are required. 4. Compare and contrast regulation of gene expression between prokaryotes and eukaryotes 5. The plasma membrane, as an example, is described as a fluid mosaic. Why? (hint: LOTS of details)

Predict the location(s) (intracellular or extracelular) and a brief description of WHY based on your knowledge of the transport processes in the following constructs. Assume a start codon is present and include any proteolytic processing that would be likely.  1. A PTS1 C-term peroxisomal targeting seq added to C term of a normally secreted protein with usual N -terminal signal sequence 2. Adding of N-terminal mitochondrial targeting sequence to protein with internal nuclear localization seq. 3. Adding N-terminal signal sequence of secreted protein to N-terminus a mitochondria matrix protein precursor with mitochondrial targeting sequence still present

Please help with this as soon as you can, thank you.

Please help answer a)

Please help answer b)

Question 2

15.3 Explain the fellovine diaeram: prospective nuclear protein nuclear Ran HYDROLYZES ITS BOUND GTP, localization Ran-GDP ignal Ran-GDP DISSOCIATES PROTEIN BINDS FROM RECEPTOR TO RECEPTOR nuclear pore CYTOSOL NUCLEUS Ran-GTP BINDS PROTEIN DELIVERED TO NUCLEUS TO RECEPTOR Ran-GTP 15.4 EXplain the followine.diBEram: SRP displaced and released for reuse MRNA ribosome signal- recognition particle (SRP) CYTOSOL growing- polypeptide chain ER signal sequence ER LUMEN SRP receptor protein translocator Ngam 1514 Iereoog ed.arinde 15.5 Explain the following.diaeram: newly synthesized soluble proteins for constitutive newly synthesized plasma membrane lipids transport vesicde secretion CONSTITUTIVE SECRETION unregulated exocytosis plasma membrane newly synthesized plasma membrane protein extracellular signal such as trans Golgi network homone or neurotransmitter signal transduction REGULATED SECRETION regulated екосуtosis secretory vesicle storing secretory proteins Golgi apparatus CYTOSOL…

1

Please answer the following question, thank you!

Which of the following statements is true regarding the two primary classes of chaperone protein complexes in eukaryotes? O both require ATP to function, but hsp70 interacts with protein targets while they are being translated O neither require ATP, but both interact with protein targets simultaneously O hsp60 complexes are huge, and interact with protein targets during translation Ohsp70 interacts with fully synthesized proteins

For each of the following, describe the path the protein takes to its final destination in the cell.Drawings are strongly recommended!Proteins: 1) Hedgehog (released from the signaling cell), 2) Smoothened, 3) Ci/GliYour answers should include the following if they apply for each protein:o Sorting sequences and how the protein knows where to go at each step (what recognizesdifferent sorting sequences/tags)o How/when the protein is inserted into the membrane (if it is a membrane protein)o What organelles the protein passes through on its way to its final destinationo How the protein is transported (vesicles? translocons? etc.), including a role for microtubuleso How the protein might be modified in each organelle it passes througho What other proteins are involved in transport and how the system is reset to allow for otherproteins to be transported

H e l p

The affinity of integrins for matrix components canbe modulated by changes to their cytoplasmic domains:a process known as inside-out signaling. You have iden-tified a key region in the cytoplasmic domains of αIIbβ3integrin that seems to be required for inside-out signaling(Figure Q19–3). Substitution of alanine for either D723in the β chain or R995 in the α chain leads to a high levelof spontaneous activation, under conditions where thewild-type chains are inactive. Your advisor suggests thatyou convert the aspartate in the β chain to an arginine(D723R) and the arginine in the α chain to an aspartate(R995D). You compare all three α chains (R995, R995A,and R995D) against all three β chains (D723, D723A, andD723R). You find that all pairs have a high level of sponta-neous activation, except D723 vs R995 (the wild type) andD723R vs R995D, which have low levels. Based on theseresults, how do you think the αIIbβ3 integrin is held in itsinactive state?

Only answer please, no need to explain… Thank you for your time. i:  Modification of the 5 prime ends of eukaryotic mRNA is called? a) Capping b) Polyadenylation c) Splicing d) Transcription ii: Genetic Code is? a) The sequence of Nitrogenous Bases in mRNA that codes for a protein b) Is a Triplet Code      c) is Non-Overlapping      d) All of these iii. The process of formation of RNA is known as a) Replication          b) DNA repair         c) Translation           d) Transcription iv. Which of the following statement is NOT true regarding transcription/RNA synthesis? a) RNA synthesis occurs in the nucleus b) Unlike DNA synthesis, the only selective sequence of DNA is transcribed to RNA   c) RNA synthesis requires a short stretch of RNA primers d) DNA sequences, specific proteins, and small RNAs regulate RNA synthesis

Tumor necrosis factor (TNF) signaling Explain in detail each step in figure 8.53.  Make sure to include an explanation of the proteolytic and phosphorylation cascades.

pls help me to do these my activity and answer properly

"There is one strict requirement for the exit of a protein from the ER: it must be correctly folded" is true or false.

Name two similarities and two differences between the cellular processes of importing protien into the ER and importing protein to the nucleus.

This is the full question.. "Both the cytokinin receptor encoded by CRE1 and the ethylene receptor encoded by ETR1 are examples of" Both the cytokinin receptor encoded by CRE1 and the ethylene receptor encoded by ETR1 are examples of O Leucine-rich repeat receptor kinase • The response regulator component of a two-component sensor histidine kinase (i.e., the component that directly activates transcription (type B ARRS, in the case of cytokinin) or directly mediates a response (type A ARRS)) O Regulatory molecules that bind calcium O The sensor histidine kinase component of a two-component sensor histidine kinase (i.e., the part that receives the signal and passes it to other components of the signal transduction cascade) O Proteins that shuttle from the cytoplasm to the nucleus to alter gene expression

Which of the following is the LEAST likely ER signal sequence? All sequences are written with their N-terminus on the left. O Met-Lys-Leu-Ser-Leu-Val-Ala-Ala-lle-Leu-Leu-Leu-Leu-Ser-Ala-Ala-Arg-Ala Met-Glu-Met-Phe-Gln-Gly-Leu-Leu-Leu-Leu-Leu-Leu-Leu-Leu-Ser-Met-Gly-Gly-Thr- Trp-Ala O Met-Lys-Ala-Lys-Leu-Leu-Val-Leu-Leu-Tyr-Ala-Phe-Val-Ala-Gly-Asn Met-Leu-Ser-Lys-Arg-Gln-Ser-Lys-Arg-Arg-Lys-Lys-Pro-Ala-Thr-Arg-Thr-Lys-Ser- Ser-Arg-Tyr-Leu

can you please help me out with this ? Mutations in the IL2RG gene cause approximately 30 percent of severe combined immunodeficiency disorder (SCID) cases in humans. These mutations result in alterations to a protein component of cytokine receptors that are essential for proper development of the immune system. The IL2RG gene is composed of eight exons and contains upstream and downstream sequences that are necessary for proper transcription and translation. Below are some of the mutations observed. For each, explain its likely influence on the IL2RG gene product (assume its length to be 375 amino acids).   Nonsense mutation in a coding region   Insertion in Exon 1, causing frameshift   Insertion in Exon 7, causing frameshift   Missense mutation   Deletion in Exon 2, causing frameshift   Deletion in Exon 2, in frame   (g) Large deletion covering Exons 2 and 3

Why are cytosolic hsp70 chaperone proteins required for import of proteins into mitochondria and chloroplasts, but not for translational import into the ER?

Q

please give thorough explanation for why answer is B plz do not answer question if u don't actually understand thank you