BIO 181 Extra Credit Assignment 4 DNA Structure

Question Guide: 1. Name and write the structures of the purine and pyrimidine bases present in DNA. Purine Рyrimidine Structures: Purine Pyrimidine

This is homework for a practice assessment. I need some assistance with these questions, so I can use them for studying material. Thank you so much! I highly appreciate it!

This is homework for a practice assessment. I need some assistance with these questions, so I can use them for studying material. Thank you so much! I highly appreciate it!

This is homework for a practice assessment. I need some assistance with these questions, so I can use them for studying material. Thank you so much! I highly appreciate it!

please help with both practice questions

Question:

question:  What is the purpose of adding table salt into the solution? What reagent is used in research labs/ Is it also table salt (NaCl)?

Instructions Using the Concord Consortium interactive, observe how mutations can affect protein formation and function. From your observations of the interactive, summarize your observations of how each change in DNA affects the protein that is made. Screenshots will be required for your assignment. Interpret and analyse your results: identify the type of mutation, and describe and explain the effect of each change on protein size, shape and polarity. Create two different mutation types and observe the different outcomes.

Worksheet-DNA 2D, synthesis and 3D With this non-graded worksheet, you will put in practice the knowledge you acquired on DNA structures and synthesis. We will go over the answers together in class and you will have plenty of opportunities to ask for clarifications The worksheet should take 60 to 90 minutes to complete and is based around: O Figure labeling O Fill in the blank questions O Multiple-choice questions OMP O HO-P-O- H₂N N 2 N N 3 1 6 Ο 5 OH 4 7 3' carbon 5' carbon Nucleoside Glycosidic bond Phosphate group NH₂ NH₂ H H₂C N N H- 1 2 3 H H O H N Purine Pyrimidine Nucleotide Nucleobase Nucleobase 1 Nucleobase 2 Nucleobase 3 Nucleobase 4 NH 4 NH₂

Give detailed Solution with explanation needed (no need Handwritten answer

Instructions In this image, the DNA fragments traveled from top to bottom. Use the drawpad to indicate the positive (+) and negative (-) ends of the gel. Remember, DNA is negatively- charged. Use two colors to circle the shortest fragment and the longest fragment in each of the five samples. 1 2 3 4 5 ||

Practice test

TRUE OR FALSE 1. Nitrogenous bases cannot undergo electrophilic aromatic substitution.2. Cytosine forms three hydrogen bonds with guanine while Adenine forms two hydrogen bonds with Thymine in themessenger RNA.3. The glycosidic bond in nucleotides is stable in dilute ammonium hydroxide solution and dilute Sodium bicarbonatesolution.4. In gel electrophoresis, a DNA is expected to migrate towards the cathode.5. Tautomerism is a phenomenon observed in both purine and pyrimidine bases.

Problem 4 DNA Sequence. Suppose that you perform shotgun sequencing and found that you got the following subsequence {CAT, TCA, AAG, GCT, GCA, ATC, CAA, AGC} What is the original sequence?

True or False? 454 platform sequencing involves attaching single -stranded DNA fragments to beads, which are embedded within a 96-well plate . The plate is exposed to separate washes of single nucleotides , which are used by DNA polymerase to synthesize complementary DNA. Each time a nucleotide is added, a pyrophosphate is released.

None

General Instruction: Answer the following questions completely. 1. Construct a Venn Diagram to compare and contrast the structure and function of DNA and RNA. DNA RNA 2. The Continuity of life is based on heritable information in the form of DNA, and structure and function are correlated at all levels of biological organization. Describe how the structure of DNA is correlated with its role as the molecular basis of inheritance. (Answer must be in 3- 5 sentences only).

Complete number five.. please explain

Please don't provide handwriting solution

Question In Image Thank you!

Please help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5 determine what amino acid will be formed from the given  DNA strand below:                          3’   T   A  C   A   T   G   C   C   G   A   A   T   G   C   C   5’ Note: Prepare the partner strand of this DNA.  Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA.  Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain.  1.  Partner DNA strand 2. the mRNA strand 3. The tRNA  4. the formed amino acids  5. the discussion of the entire procedure

2.4 INSTRUCTIONS — Do not copy in Google or Bartleby. Plagarize Checker will be used

Worksheet-DNA 2D, synthesis and 3D With this non-graded worksheet, you will put in practice the knowledge you acquired on DNA structures and synthesis. We will go over the answers together in class and you will have plenty of opportunities to ask for clarifications The worksheet should take 60 to 90 minutes to complete and is based around: O Figure labeling O Fill in the blank questions O Multiple-choice questions H₂N N 2 N OMPIO HO-P-O- 1 6 Ο 5 OH N 4 3 7 3' carbon 5' carbon Nucleoside Glycosidic bond Phosphate group NH₂ NH₂ H. H₂C N N H 1 2 3 N H H Ο H Purine Pyrimidine Nucleobase 1 Nucleobase 2 Nucleotide Nucleobase Nucleobase 3 Nucleobase 4 4 NH NH₂

Instruction - Please answer them correctly - Please answer all of them, they are connected. MUTATION Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) e. What is the most convincing type of mutation had occurred? (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)

Question:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCG

Need help in 1 & 2 And if possible Analysis 1,2,&3

Task 1: Compare the characteristics of DNA to RNA. Think before you drop - This is an all or nothing type of question. Double check that you are happy with where you placed all of the options before you submit the knowledge check. DNA RNA No Answers Chosen No Answers Chosen DNA & RNA No Answers Chosen Possible answers Phosphate group | Cytosine Adenine Basic unit is the nucleotide Single strand Double helix E Phosphate-sugar backbone | Uracil | Guanine | Thymine :::: ::::

I’m kinda confused on what to study for the test and what questions are gonna be on there but this PowerPoint but I just want you to explain the microbiology screenshots to me in a way I can clearly understand, I need a tutor

**not sure if you needed the second picture** Please complete number one. Explain how to figure it out. Thank you so much!

ule 11 Making Cells – 202 Bb Module 11 Making Cells - 2021 X Bb Take Test: "Lab 11 Homework - X + A sunyocc.open.suny.edu/webapps/assessment/take/launch.jsp?course_assessment_id=_109869_1&course_id=_53817_1&c Question Completion Status: D. Organelle A. Two identical that builds copies of DNA microtubule "highways" to guide DNA B. "staple" that holds DNA copies together C. DNA that is same length and has same instructions; one from mother and one from father Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All Answers MacBook DD 00 000 F8 F6 F7 F4 F5 F2 F3 F1 * $ % & @ # 2 3 4 * CO < O

66