Bio-Info week 3 assignment

Tn Midterm test Fall 2020 (page 2 of x A elearn.squ.edu.om/mod/quiz/attempt.php?attempt3D1335328&cmid%3D6971498page=1 SQU E-leaning System (Academic) Question 21 The direction of mRNA molecule synthesis is .: Not yet answered Select one: Marked out of O a. From DNA strand that starts with 5' 1.00 O b. In the direction of 3' to 5 P Flag question O c. From DNA strand that starts with 3' O d. From RNA strand that starts with 3' O e. From RNA strand that starts with 5' Question 22 Which of the following organelles do plants and animals have in common? Not yet answered Select one: Marked out of O a. mitochondria, ribosome, nucleus, cell membrane, cytoplasm 1.00 O b. mitochondria, vacuole, nucleus, cell membrane, cell wall F Flag question O c. mitochondria, vacuole, nucleus, cell membrane, centrioles O d. mitochondria, vacuole, nucleus, cell membrane, cell wall, chloroplasts O e. mitochondria, vacuole, nucleus, cytoplasm, cell wall, lysosome

QUESTION:- Whole genome sequencing provides the most comprehensive genomic information. Nevertheless, there are many instances when microarrays or limited sequencing of a selected panel of genes are the approaches chosen for clinical use , Why?

hello can you explain the steps for both questions here and thanks

Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC   1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.

Instruction - Please answer them correctly - Please answer all of them, they are connected. MUTATION Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) e. What is the most convincing type of mutation had occurred? (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)

Instructions: Read 13-2 Manipulating DNA pages 322-323. As you read each section, examine the figures and captions (explanations). Identify any questions you may have. 1) Develop an analogy for the processes researchers use to make changes to DNA. In yo analogy, explain how it is similar to the techniques used in genetic engineering. You can draw a graphic organizer, make a table, or write a few sentences describing your analogy. 2) Devise flowchart that shows the steps to prepare DNA for gel electrophoresis, as well the protocol for setting up and running a gel. You can add diagrams to the flowchart an add detailed notes if you like. English (inited Sate) O Focs ere to search 4 CO RU G\ L B. 2N A\ Alt Ciri

please help with question 1 and 2.

Question. Rewrite the following sentences after correction. (Subject: Biotechnology) The variation in the length of tandem repeat of microsatellite DNA has serious translational affects as this is due to its coding region. Correct: If one parent has sickle cell anemia and other has carrier genotype than there is 25 % chance that any offspring is carrier. Correct: Sickled WBC block the flow of blood and Calcium as they stick together and caused by frame shift mutation. Correct: The N1303K mutation in the CFTR gene of CF patients is autosomal dominant disorder due to insertion of asparagine at 1303. Correct: If a person RBCs have B surface antigen and it will clump with antigen B such clumping indicates Blood type B. Correct: Indirect ELISA can detect polygenic gene expression. Correct:

Please help witht this homework question A- What are the topological parameters (linking number, twist, and writhe)for a relaxed, 4,200 base pair circular double-stranded DNA plasmid? LK=?   Tw= ?   Wr=? The CRISPR-Cas9 protein first forms a protein-RNA complex with a guide RNA, and then binds to DNA sequences that match a 20-base target sequence within the guide. When the CRISPR-Cas9 complex binds to DNA, it unwinds about 20 base pairs of the DNA double helix. B- Why is DNA unwinding required for CRISPR-Cas9 protein-RNA complexto recognize target sites? C-How would the topological parameters (linking number, twist, andwrithe) of the 4,200 bp plasmid in (A) change when the CRISPR-Cas9 complex binds the DNA and unwinds about 20 bp? Lk=?  Tw=?  Wr=?  D- What is the linking number after the CRISPR-Cas9 complex cleaves theDNA?

Instructions -Answer thr Questions properly. MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA "MUTATED DNA" (SEE IMAGE) a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) e. What is the most convincing type of mutation had occurred? - Substitution - Missense (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)

Please answer fast

solve all 3 questions and typed answer please

MCQ QUESTION: In Bacteria, the UV-induced DNA damage will be repaired by ------- where -------- nitrogenous base is targeted. A- Photoreactivation repair/ b- thymine SOS repair/ C-adenine Mismatch repair/ D- cytosine Proofreading/guanine     The DNA sequence (5'-ATACAMA-3') was exposed to Ethyl Methanesulfonate (EMS) which is a(n) _______ . The resulting DNA sequence will become __________ after one round of cell division.

Question:- When completing genome sequences, contiguous sequences, or contigs are important intermediates. Which of the following is true about contigs? Group of answer choices   The smaller the contig, the better it is for a complete genome assembly.   A contig represents the sequence production from a single sequencing reaction.   A contig is the name for a fragment of DNA made from a larger genomic DNA or chromosome, prior to its sequencing.   A contig represents a DNA sequence assembled from smaller sequencing reads, and has no gaps.

typed answer and atremt all questions please

Direction: On the worksheet, all the DNA sequences run from 3' to 5'. Supply the corresponding amino acid base on the DNA sequence provided per item. Determine the type of mutation and explain its effect on the expression of amino acids. 1. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT inim Mutated Sequence: TAC TCG GCT CTC CCA GTT GAA CT Original Amino acid: Mutated Amino Acid: What mutation have occurred in the sequence? How does it affect the expression of amino acids? 2. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCT GGC TCT CCA AGT TGA ACT ww mm Original Amino acid: Mutated Amino Acid: What mutation has occurred in the sequence? How does it affect the expression of amino acids?

PLease help, double and triple check your answers, im using this to study, these questions are NOT graded they are PRACTICE problems

ME History Bookmarks Profiles Tab Window Help ucture.com/courses/47420/quizzes/225324/take Question 3. Choose the best method (from lectures 19-21) for each of the following experiments. You want to determine the transcriptomic response to heat shock in [ Choose ] a normal cell line. You'want to measure the quantity of mRNA of your gene of interest in sepal vs petal cells. [ Choose ] You want to identify the mutation that has occurred in your gene o V [ Choose ] interest after EMS mutagenesis. CRISPR Map based sequencing or whole genome shotgun sequencing You want to know the DNA sequence of all of the genes in a Recombinant DNA genome. Restriction enzyme digest RT-PCR or qPCR You want to make large quantities of DNA of your gene of interest from a tiny amount of DNA. Sanger sequencing PCR You want to determine the differences between the proteins made Cloning in the sepal vs petal cells. Microarray or RNA-seq Proteomics Question 12

Question: Some scientists have concluded that this method of gene therapy will be a more effective long-term treatment for SCD than HSCT. Use all the information provided to evaluate this conclusion. I dont know how to answer this question pls help:(

Question in photo

GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…

are my answers correct? please check them

Please help with all parts of this problem. Double check your answers.

Pls can anyone explain how to solve this exercise and it means? thank you sm!

Question In Image Thank you!

Concept Overview: Protein Synthesis Task 2: Review the process of protein synthesis by placing the cards in their appropriate category. Think before you drop - This is an all or nothing type of question. Double check that you are happy with where you placed all of the options before you submit the knowledge check. Transcription Translation No Answers Chosen No Answers Chosen Transcription & Translation Neither No Answers Chosen No Answers Chosen Possible answers DNA is copied into MRNA Involves tRNA | Occurs in the mitochondria Information in MRNA is used to produce a protein Occurs in the nucleus Involves mRNA Utilizes ribosomes Involves DNA polymerase Involves RNA polymerase Occurs in the cytoplasm :::: :::: ::::

Primer Designing:

Please answer fast

Search (Option + Q) Review View Help Editing v B IU ev Av A =<而< 面 三< A Question 16 The full set of different transcripts expressed by a cell is called Proteome Genome Transcriptome Glycome Question 17 One of the major drawback of using Microarray over RNA sequencing for high throughput sequence analysis is allows quantification of transcripts over five orders of magnitude usei to identify new transcripts and alternative isoforms RNA-Seq is sensitive and offers a way of profiling transcripts of single cells a significant amount of input RNA is required Question 18 Which of these statements are not true for the DNA libraries: Genomic DNA libraries are collection of cloned DNA fragments representing the genome from an organism. Genomic DNA is completely (fully) digested with restriction endonuclease. Complementary DNA (CDNA) libraries are derived from reverse transcribed RNA Genomic DNA is partially digested with restriction endonuclease.

Need help in 1 & 2 And if possible Analysis 1,2,&3

Could I get some assistance with this please.