1 Making contact Origin of transfer Integrated F plasmid Chromosome Chromosomal genes Donor cell Hfr Recipient cell F The F pilus contacts the recipient F cell. 2 Transferring DNA Origin of transfer Origin of transfer- A single strand of the donor chromosome begins to be transferred, starting at the origin of transfer. Gene A, closest to the origin, is transferred first. DNA synthesis creates complementary strands in both cells. 3 Transfer ends The donor and recipient cells separate, interupting DNA transfer. 4 Integratlon of transferred DNA Hfr cell Fcell The donor DNA is integrated into the recipient cell's chromosome by homologous recombination. Unincorporated DNA is degraded. The recipient cell is still F. FIGURE 8.24 Conjugation-Chromosomal DNA Transfer. The letters A, B, and Cindicate genes in the Hfr cell; the letters a', b' and c' indicate homologous but slightly different genes in the F cell.

1 Making contact Origin of transfer Integrated F plasmid Chromosome Chromosomal genes Donor cell Hfr Recipient cell F The F pilus contacts the recipient F cell. 2 Transferring DNA Origin of transfer Origin of transfer- A single strand of the donor chromosome begins to be transferred, starting at the origin of transfer. Gene A, closest to the origin, is transferred first. DNA synthesis creates complementary strands in both cells. 3 Transfer ends The donor and recipient cells separate, interupting DNA transfer. 4 Integratlon of transferred DNA Hfr cell Fcell The donor DNA is integrated into the recipient cell's chromosome by homologous recombination. Unincorporated DNA is degraded. The recipient cell is still F. FIGURE 8.24 Conjugation-Chromosomal DNA Transfer. The letters A, B, and Cindicate genes in the Hfr cell; the letters a', b' and c' indicate homologous but slightly different genes in the F cell.

Name: Why is the entire donor chromosome seldom transferred? 1 Making contac
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Why is the entire donor chromosome seldom transferred? 1 Making contactOrigin oftransferIntegratedF plasmidChromosomeChromosomalgenesDonor cell HfrRecipient cell FThe F pilus contacts the recipient F cell.2 Transferring DNAOrigin oftransferOrigin oft

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 13P

See similar textbooks

Similar questions

#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
13. In bacteria, mismatch repair involves:A. DNA glycosylase/lyaseB. AP endonucleaseC. RecA and LexA proteinsD. MutS, MutL and MutH proteinsE. UvrABC proteins 14. _______ involves an exchange of DNA between two interacting DNA molecules.A. TransferenceB. TranspositionC. Crossing overD. InductionE. None of the above 15. The bacterial core polymerase has two functions: 5' to 3' polymerase activity and _________________ activity.A. 5' to 3' exonucleaseB. 3' to 5' polymerase C. 3' to 5' exonuclease D. topoisomeraseE. none of the above
A set of cells that host various DNA fragments collectively representing an organisms entire set of genetic information is a _________. a. genome b. clone c. genomic library d. GMO
After DNA replication, a eukaryotic chromosome ______. a. consists of two sister chromatids b. has a characteristic X shape c. is constricted at the centromere d. all of the above
A chromosome contains many different genes that are transcribed into different ___ . a. proteins b. polypeptides c. RNAs d. a and b
The results of a paternity test using short tandem repeats are listed in the table below. Whos the daddy? How sure are you?
The chromosome number ______. a. refers to a particular chromosome in a cell b. is a characteristic feature of a species c. is the number of autosomes in cells of a given type d. is the same in all species
2. You are cloning the genome of a new DNA virus into pUC18. You plate out your transformants on ampicillin plates con-taining X-gal and pick one blue colony and one white colony. When you check the size of the inserts in each plasmid (blueand white), you are surprised to fi nd that the plasmid fromthe blue colony contains a very small insert of approximately60 bp, while the plasmid from the white colony does notappear to contain any insert at all. Explain these results.
#3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
An ade+ arg+ cys+ his+ leu+ pro+ bacterial strain is knownto be lysogenic for a newly discovered phage, but the siteof the prophage is not known. The bacterial map isleucysarghisadeproThe lysogenic strain is used as a source of the phage, andthe phages are added to a bacterial strain of genotypeade- arg- cys- his- leu- pro-. After a short incubation,samples of these bacteria are plated on six differentmedia, with the supplementations indicated in thefollowing table. The table also shows whether colonieswere observed on the various media.PresenceMedium Ade Arg Cys His Leu Pro of colonies1 - + + + + + N2 + - + + + + N3 + + - + + + C4 + + + - + + N5 + + + + - + C6 + + + + + - NNutrient supplementation in medium(In this table, a plus sign indicates the presence of anutrient supplement, a minus sign indicates that asupplement is not present, N indicates no colonies, and Cindicates colonies present.)a. What genetic process is at work here?b. What is the approximate locus of the prophage?
5’ ATGCTAGACGTGTTCTAG 3’3’ TACGATCTGCACAAGATC 5’Moving from left to right, the bottom DNA strand will be read continuously.a. Tb. F
1. It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand:GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT