1.c)B vitamins are involved in energy production. must be injected to be effective. are fat-soluble. are termed "B" for body building. are only available as supplements by prescription.
Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…
A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…
Q: Focusing on the mechanism linking complex I and ATP synthase depicted in figure 3 in the article,…
A: Peter Mitchell in t the chemiosmotic theory proposed that there exists a membrane localized,…
Q: True of false 6. In glycogen synthesis, the active form of glucose is UDPG. () 7. If people lack…
A: Glycogenesis : It is the process of synthesis of glycogen from glucose. Glycogen is a polymer of…
Q: Why two strands of DNA are not identical but are complimentary to each other?
A: Introduction DNA acts as genetic material in our body. DNA consists of nitrogenous bases, pentose…
Q: CHOOSE THE ANSWER FROM THE FOLLOWING CHOICES: Phosphodiester Bond Glycosidic Bond Ester…
A: Nucleic acid can be of 2 types: DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Nucleic acids…
Q: Which outcome most likely results from exposure of Ogg1 mice to TNFa O A. Increase in cancer…
A: DNA and RNA are biomolecules that carry genetic information between different generations of cells.…
Q: 9. Briefly describe and draw the structure of the following disaccharides in their ring structure.…
A: A. Sucrose structure: O O| || || |O-C-O-C-H H-C-O-C-O| || || |H H B. Maltose structure: O O| || ||…
Q: Give one example of a disease and briefly explain the molecular basis of the disease. apply the…
A: INTRODUCTION : Diseases and pathological conditions : A disease is a pathological condition in which…
Q: PLEASE HELP How many stereoisomers or ribose are there?
A: Stereoisomers are the isomeric molecular structures with same composition but with different…
Q: TRUE OR FALSE 1. Rotational entropy is the freedom to move in three-dimensions. 2. Vitamin B1…
A: In the cellular environment, the condition do not allow biochemical reactions to occur at…
Q: Question 37 The following peptides were measured for a longer sequence that you are interested in…
A: The proteins are composed of twenty naturally occurring amino acids. According to Anfinsen's…
Q: IDENTIFICATION: 1.Complex organic compound w/c has the ability of speeding chemical reactions w/out…
A: Since you have posted multiple questions, we will provide the solution only to the first five…
Q: b) How does oxygen availability determine the fate of the glycolysis pathway?
A: Glycolysis is a central metabolic pathway that is used by all cells for the oxidation of glucose for…
Q: Draw a schematic diagram illustrate the interactions made between the key components of total and…
A: Ligand and protein binding is vital phenomenon in our body for enzyme-substrates, enzyme-inhibitors,…
Q: Explain the reason why sugars that are polysaccharides are almost always insoluble in ethanol. B.…
A: Sugars are sweet tasting carbohydrates . Polysaccharides are carbohydrates made up of numerous…
Q: MATCHING TYPE a. Peroxidase b. Thrombin c. Amylase d. Diastase e. Amylopsin f. Invertase or Sucrase…
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They are also called…
Q: A TCL was run with 5 subjected samples utilizing a silica plate and ethanol/chloroform in mobile…
A: TLC (thin layer chromatography) is a type of partition chromatography, in which the samples are…
Q: 8. [1-¹4C]Glucose Catabolism An actively respiring bacterial culture is briefly incubated with…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: As we grow up or old, metabolism gets faster or slower?
A: Metabolism is the process that involves catabolism and anabolism . These are the reactions during…
Q: These enzymes form covalent intermediates A. Papain B. Alkaline phosphatase C. Elastase D. All of…
A: Enzymes are biological catalysts that increases the rate of the reaction. They do so by having a…
Q: Draw the potential tautomers of guanine. Based on Question 1c) (i), label the patterns of hydrogen…
A: Guanine is a nucleotide base found in nucleic acids like DNA and RNA . It pairs with Cytosine with…
Q: Figure 1 shows the structure of adenine and thymine. (i) (ii) NH H adenine -H =C thymine Figure 1…
A: These are cyclic compounds that contain nitrogen. They can be: Purines: a heterocyclic organic…
Q: 2. A mutation that changes an alanine residue in the interior of a protein to valine (A157 → V157)…
A: Different protein gain its three dimensional structure after folding, which occurs according to the…
Q: 1. What is gluconeogenesis? 2. Explain the biochemical effects underlying the metabolic functions of…
A: Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: A) Polymer Lipid DNA B) Monomer (or component units in the case of lipids). Draw the specific…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: The folding of an unfolded protein proceeds from low entropy disordered state to a single high…
A: Many proteins achieve their natural conformations in a matter of milliseconds or less. This is due…
Q: explain the following prperties of G protein: structure of G- activation cycle and signaling pathway…
A: G proteins are the Guanine nucleotide binding proteins which functions in transducing signals…
Q: A 42 yr old woman is not in shape but still decides to run a marathon. During the event, she…
A: The blood homeostasis plays crucila role during respiration and breathing. The precursors of enegy…
Q: If you wanted to estimate the molecular weight of a newly isolated protein (no known amino acid…
A: If you want to estimate the molecular weight of a newly isolated protein with no known amino acid…
Q: Many enzyme -catalyzed reactions are consistent with a modified version of the Michaelis -Menten…
A: E+S⇌k-1k1Es⇌k-2k2E+P.......................(1) Considering above Michaelis Menten Equation where…
Q: When protein is converted in the body to amino acids, what is the role of water? Only beef proteins…
A: Proteins are essential nutrients that the body needs to function properly. They are important for…
Q: Give 10 examples of enzymes that use NAD/ NADH and NADP/ NADPH and their functions.
A: NAD/NADH and NADP/NADPH act as intermediates in several biochemical reactions. NAD+/NADH and…
Q: Create a concept map connecting cancer and glycolysis (warburg effect)
A: Introduction:- The question is all about the cancerous cells that connect with Glycolysis cycle that…
Q: Create a concept map connecting diabetes and gluconeogenesis inhibitors
A: Gluconeogenesis is the metabolic pathway that generates glucose from non-carbohydrate precursors.…
Q: Which fibrous protein is found in connective tissue and consists of 3 left-handed helices twisted…
A: Fibrous proteins are a large class of proteins which provide strength and/or flexibility to the…
Q: Describe how each of the following relates to protein configuration: primary structure - secondary…
A: As per the central dogma of molecular biology, DNA contains the code that is necessary for the…
Q: QUESTION 03 - Regarding the amino acid arginine, answer the following questions: (Data: pka NH₂ Lyd…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group linked to…
Q: Draw estimated macroscopic currants for Na and k by multiplying the single channel
A: The sodium-potassium pump is also known as the Na+/K+ ATPase pump. It is a type of active transport…
Q: Fill in the blank 1.) triaycerols form_____ rather than lipid bolsters 2.) the most abundant…
A: Triacylglycerols are fatty acid esters of glycerols, with 3 fatty acids (long hydrocarbon chain…
Q: Why was it necessary to use phosphoaminophosphonic acid-adenylate ester (ANP) in the ATP synthase…
A: As per the chemiosmotic Model, ATP synthase is the enzyme that phosphorylates ADP with Pi as…
Q: With, Asp-Cys-Lys-Arg What are the pH buffering regions (pH range)? What is the charge at ph 4?
A: Peptides are made up of amino acids. Every amino acid have an alpha-carbon that is bonded to 4…
Q: Deduce the amino acid sequence of a polypeptide from the following: 1. Acid hydrolysis gives Ala2,…
A: Deducing the amino acid sequence of a polypeptide from the analysis of peptide fragments generated…
Q: compare that hypothetical mechanism to the classical presentation described in our textbook. What…
A: ETC is an arrangement of protein complexes and some non-protein components in an increasing redox…
Q: n a-c below, will the residue on the right-hand side increase or decrease the pKa of the residue on…
A: Amino acids that do not have ionisable side chains are zwitterion at neutral pH since they have an…
Q: Sulfur compounds give onions their unique flavor and properties. Compound 1 is the starting material…
A: Allinase is an enzyme which catalyzes a biochemical reaction in which S-alkyl-L-cysteine S-oxide…
Q: What is the effect on the biosynthetic pathways if the oxidative branch of a person’s pentose…
A: The pentose phosphate pathway (PPP) is an alternate pathway to metabolize Glucose 6-phosphate…
Q: Draw the structure of the a-keto acid formed by the transamination of each amino acid: (a) tyrosine…
A: Transamination is a type of reaction in which, the amino group of an amino acid is transferred as a…
Q: With fatty infiltration of the liver, the synthesis of phospholipids is disturbed. What is the…
A: Fatty infiltration of the liver, also known as steatosis, occurs when there is an excessive…
Q: Sugar Molisch's Solution Test Glucose Sucrose Lactose Hydrolysis: Samples Sucrose hydrolysate Starch…
A: Qualitative tests are used to determine for the presence or absence of any substance in the given…
Q: 1. What are buffers? 2. Using the pH scale, describe how you can indicate if the blood solution is…
A: Buffers are chemical systems which allows a solution to have a stable pH. Most buffers can help…
NO NEED FOR EXPINATION JUST THE ANSWER THANKS. PLEASE ANSWER the questions correlty and please answer all the questions with what it regards in saying exactly, please and thank you NEED THE ANSWERS IN 30 MINTUES. Ive read the guide lines and honor code that i can have up to Submit only one question at a time under the appropriate subject. A question can have up to 3 subparts (i.e. part a, b, and c). If you dont belive me here is the link of barthleby saying exactly that thanks: https://bartleby.zendesk.com/hc/en-us/articles/360017462394-How-can-I-ensure-my-questions-get-answered-as-quickly-as-possible-
1.c)B vitamins
- are involved in energy production.
- must be injected to be effective.
- are fat-soluble.
- are termed "B" for body building.
- are only available as supplements by prescription.
Step by step
Solved in 2 steps
- NO NEED FOR EXPINATION JUST THE ANSWER THANKS. PLEASE ANSWER the questions correlty and please answer all the questions with what it regards in saying exactly, please and thank you NEED THE ANSWERS IN 30 MINTUES. Ive read the guide lines and honor code that i can have up to Submit only one question at a time under the appropriate subject. A question can have up to 3 subparts (i.e. part a, b, and c). If you dont belive me here is the link of barthleby saying exactly that thanks: https://bartleby.zendesk.com/hc/en-us/articles/360017462394-How-can-I-ensure-my-questions-get-answered-as-quickly-as-possible-NO NEED FOR EXPINATION JUST THE ANSWER THANKS. PLEASE ANSWER the questions correlty and please answer all the questions with what it regards in saying exactly, please and thank you NEED THE ANSWERS IN 30 MINTUES. Ive read the guide lines and honor code that i can have up to Submit only one question at a time under the appropriate subject. A question can have up to 3 subparts (i.e. part a, b, and c). If you dont belive me here is the link of barthleby saying exactly that thanks: https://bartleby.zendesk.com/hc/en-us/articles/360017462394-How-can-I-ensure-my-questions-get-answered-as-quickly-as-possible- 1.b)Which one of the following is correct concerning flaxseed? It contains only omega-6 fats. It has a constipating effect. It contains lignans which have possible anti-cancer effects. It is low in fiber. It is not safe for human consumption.NO NEED FOR EXPINATION JUST THE ANSWER THANKS. PLEASE ANSWER the questions correlty and please answer all the questions with what it regards in saying exactly, please and thank you NEED THE ANSWERS IN 30 MINTUES. Ive read the guide lines and honor code that i can have up to Submit only one question at a time under the appropriate subject. A question can have up to 3 subparts (i.e. part a, b, and c). If you dont belive me here is the link of barthleby saying exactly that thanks: https://bartleby.zendesk.com/hc/en-us/articles/360017462394-How-can-I-ensure-my-questions-get-answered-as-quickly-as-possible- 1.a)The red-vented bulbul (bird) is famous and almost unique amongst many animals because it flew from Montreal to Ottawa to speak with Prime Minister Trudeau recently flew with President Biden to Ukraine. recently flew to London to see Prince Harry but was refused entry because the Prince was in California. eventually voted to oust Prime Minister Boris Johnson for bad behaviour at…
- NO NEED FOR EXPINATION JUST THE ANSWER THANKS. PLEASE ANSWER the questions correlty and please answer all the questions with what it regards in saying exactly, please and thank you NEED THE ANSWERS IN 30 MINTUES. Ive read the guide lines and honor code that i can have up to Submit only one question at a time under the appropriate subject. A question can have up to 3 subparts (i.e. part a, b, and c). If you dont belive me here is the link of barthleby saying exactly that thanks: https://bartleby.zendesk.com/hc/en-us/articles/360017462394-How-can-I-ensure-my-questions-get-answered-as-quickly-as-possible- 1.a)A recent study investigated the effects of sugar-sweetened beverages on type II diabetes. The researchers pooled data from 18 eligible studies and performed statistical analysis on it. They found a significant association between the consumption of sugar sweetened beverages and type II diabetes. Which one of the following study types best matches the description above? Cohort study…NO NEED FOR EXPINATION JUST THE ANSWER THANKS. PLEASE ANSWER the questions correlty and please answer all the questions with what it regards in saying exactly, please and thank you NEED THE ANSWERS IN 30 MINTUES. Ive read the guide lines and honor code that i can have up to Submit only one question at a time under the appropriate subject. A question can have up to 3 subparts (i.e. part a, b, and c). If you dont belive me here is the link of barthleby saying exactly that thanks: https://bartleby.zendesk.com/hc/en-us/articles/360017462394-How-can-I-ensure-my-questions-get-answered-as-quickly-as-possible- 1.a)The red-vented bulbul (bird) is famous and almost unique amongst many animals because it flew from Montreal to Ottawa to speak with Prime Minister Trudeau recently flew with President Biden to Ukraine. recently flew to London to see Prince Harry but was refused entry because the Prince was in California. eventually voted to oust Prime Minister Boris Johnson for bad behaviour at…PLEASE ANSWER the questions correlty and please answer all the questions with what it regards in saying exactly, please and thank you take your time. Ive read the guide lines and honor code that i can have up to Submit only one question at a time under the appropriate subject. A question can have up to 3 subparts (i.e. part a, b, and c). If you dont belive me here is the link of barthleby saying exactly that thanks: https://bartleby.zendesk.com/hc/en-us/articles/360017462394-How-can-I-ensure-my-questions-get-answered-as-quickly-as-possible- 1.a)What is a core component of the peer review process that aims to prevent subjectiveopinion influencing the decision to publish a paper? The reviews are randomly assigned to two groups that receive different parts ofthe paper The referee(s) repeat the procedures outlined by the researcher to test thevalidity of the paper. The paper is made available to the public so that the entire community mayreview it prior to publication. The referee(s) and…
- PLEASE ANSWER the questions correlty and please answer all the questions with what it regards in saying exactly, please and thank you take your time. Ive read the guide lines and honor code that i can have up to Submit only one question at a time under the appropriate subject. A question can have up to 3 subparts (i.e. part a, b, and c). If you dont belive me here is the link of barthleby saying exactly that thanks: https://bartleby.zendesk.com/hc/en-us/articles/360017462394-How-can-I-ensure-my-questions-get-answered-as-quickly-as-possible-PLEASE ANSWER the questions correlty and please answer all the questions with what it regards in saying exactly, please and thank you take your time. Ive read the guide lines and honor code that i can have up to Submit only one question at a time under the appropriate subject. A question can have up to 3 subparts (i.e. part a, b, and c). If you dont belive me here is the link of barthleby saying exactly that thanks: https://bartleby.zendesk.com/hc/en-us/articles/360017462394-How-can-I-ensure-my-questions-get-answered-as-quickly-as-possible- 1.a)High fructose corn syrup (HFCS) normally has approximately what composition? ('>means more than) dextrose > mannose mannose > dextrose glucose fructose fructose> mannose fructose glucose 1.b)Calcium propionate (propanoate) is the substance in oat bran that reduces cholesterol. is only found in plant foods. is used to sweeten soft drinks. inhibits the growth of moulds. is a suspected carcinogen. 1.c)Which one of the following…PLEASE ANSWER the questions correlty and please answer all the questions with what it regards in saying exactly, please and thank you take your time. Ive read the guide lines and honor code that i can have up to Submit only one question at a time under the appropriate subject. A question can have up to 3 subparts (i.e. part a, b, and c). If you dont belive me here is the link of barthleby saying exactly that thanks: https://bartleby.zendesk.com/hc/en-us/articles/360017462394-How-can-I-ensure-my-questions-get-answered-as-quickly-as-possible- 1.a)Zinc levels in the blood cannot be accurately determined. has no known level at which it becomes toxic. is only found in foods of animal origin. cannot be supplied in adequate amounts in the diet without supplements. none of the responses is correct. 1.b)Fosamax, a drug to treat osteoporosis functions by increasing the activity of calcitonin. increasing estrogen levels. increasing vitamin D levels. decreasing bone loss by blocking…
- PLEASE ANSWER the questions correlty and please answer all the questions with what it regards in saying exactly, please and thank you take your time. Ive read the guide lines and honor code that i can have up to Submit only one question at a time under the appropriate subject. A question can have up to 3 subparts (i.e. part a, b, and c). If you dont belive me here is the link of barthleby saying exactly that thanks: https://bartleby.zendesk.com/hc/en-us/articles/360017462394-How-can-I-ensure-my-questions-get-answered-as-quickly-as-possible- 1.a)The red-vented bulbul (bird) is famous and almost unique amongst many animals because it flew from Montreal to Ottawa to speak with Prime Minister Trudeau recently flew with President Biden to Ukraine. recently flew to London to see Prince Harry but was refused entry because the Prince was in California. eventually voted to oust Prime Minister Boris Johnson for bad behaviour at 10Downing Street. does not make its own vitamin C. 1.b)Which one…PLEASE ANSWER the questions correlty and please answer all the questions with what it regards in saying exactly, please and thank you take your time. Ive read the guide lines and honor code that i can have up to Submit only one question at a time under the appropriate subject. A question can have up to 3 subparts (i.e. part a, b, and c). If you dont belive me here is the link of barthleby saying exactly that thanks: https://bartleby.zendesk.com/hc/en-us/articles/360017462394-How-can-I-ensure-my-questions-get-answered-as-quickly-as-possible- 1.a) Which one of the following would be a component of innate immunity? antigen SARS-CoV-2 antibodies stomach acid histamine spike protein 1.b)Recall that fruit juices and colas have roughly the same amount of sugar. What canyou conclude about the health impacts of juices and colas? The sugars found in the fruit juice are healthier than the sugars in the colas. The phytochemicals in fruit juice prevent an increase in blood glucose. Both fruit…PLEASE ANSWER the questions correlty and please answer all the questions with what it regards in saying exactly, please and thank you take your time. Ive read the guide lines and honor code that i can have up to Submit only one question at a time under the appropriate subject. A question can have up to 3 subparts (i.e. part a, b, and c). If you dont belive me here is the link of barthleby saying exactly that thanks: https://bartleby.zendesk.com/hc/en-us/articles/360017462394-How-can-I-ensure-my-questions-get-answered-as-quickly-as-possible- 1.a)Identify the disaccharide in the list below. Lactose Glucose Dextrose Galactose Fructose 1.b)In terms of credit for the discovery of the structure of DNA, pick the correct answer It has been made clear by careful research that Rosalind Franklin was not given the prize because she was a woman. There were only two winners of the prize for DNA, VWatson and Crick. Linus Pauling was included with Watson and Crick in the Nobel Prize. Oswald Avery…