31. CRISPR #1: A key revelation in the CASCADE-DNA structure is that DNA is engaged with crRNAs in 5-base pair blocks, with every sixth base unpaired. It was proposed that the crRNA 'seed' containing the 5-nucleotide stretches are 'pre-ordered' for DNA pairing due to their proximity to the protospacer adjacent motif (PAM). Unfortunately, the PAM nucleotides are disordered in the CASCADE-DNA structure (in addition to the opposing DNA strand). This is likely because this region is dynamic in the final X-ray structure. Why is the PAM region so important in the CRISPR mechanism?

31. CRISPR #1: A key revelation in the CASCADE-DNA structure is that DNA is engaged with crRNAs in 5-base pair blocks, with every sixth base unpaired. It was proposed that the crRNA 'seed' containing the 5-nucleotide stretches are 'pre-ordered' for DNA pairing due to their proximity to the protospacer adjacent motif (PAM). Unfortunately, the PAM nucleotides are disordered in the CASCADE-DNA structure (in addition to the opposing DNA strand). This is likely because this region is dynamic in the final X-ray structure. Why is the PAM region so important in the CRISPR mechanism?

Name: 31. CRISPR #1: A key revelation in the CASCADE-DNA structure is that
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 31. CRISPR #1: A key revelation in the CASCADE-DNA structure is that DNA is engagedwith crRNAs in 5-base pair blocks, with every sixth base unpaired. It was proposedthat the crRNA 'seed' containing the 5-nucleotide stretches are 'pre-ordered' forDNA

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

32. CRISPR #2: The CASCADE-DNA structure reveals the configuration of the crRNA- DNA duplex but it does not show how the subsequent nuclease DNA degradation step occurs. This DNA degradation step requires the Cas3 helicase-endonuclease enzyme. Cas3 is subsequently able to unwind and degrade the invading DNA. How does Cas3 specifically target the invading DNA?
. You have identified a mutation in yeast, a unicellular eukaryote, that prevents the capping of the 5′ end of theRNA transcript. However, much to your surprise, all theenzymes required for capping are normal. You determine that the mutation is, instead, in one of the subunitsof RNA polymerase II. Which subunit is mutant, andhow does this mutation result in failure to add a cap toyeast RNA?
In which direction along the template must theRNA polymerase in Figure Q6–1 be moving to have gen-erated the supercoiled structures that are shown? Wouldyou expect supercoils to be generated if the RNA poly-merase were free to rotate about the axis of the DNA as itprogressed along the template?
E22. The method of Northern blotting is used to determine the amount and size of a particular RNA transcribed in a given cell type. Alternative splicing (discussed in Chapter 12) produces mRNAs of different lengths from the same gene. The Northern blot shown here was made using a DNA probe that is complementary to the MRNA encoded by a particular gene. The mRNA in lanes 1 through 4 was isolated from different cell types, and equal amounts of total cellular MRNA were added to each lane. 2 3 4 Lane 1: MRNA isolated from nerve cells Lane 2: MRNA isolated from kidney cells Lane 3: MRNA isolated from spleen cells Lane 4: MRNA isolated from muscle cells Explain these results. | |
Imagine a warm pond on the primordial Earth.Chance processes have just assembled a single copy of anRNA molecule with a catalytic site that can carry out RNAreplication. This RNA molecule folds into a structure thatis capable of linking nucleotides according to instructionsin an RNA template. Given an adequate supply of nucleo-tides, will this single RNA molecule be able to use itself as atemplate to catalyze its own replication? Why or why not?
A fragment of bacterial DNA reads: 3’ -TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would he transcribed? (Hint: Be sure to identify the initiation site.)
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
34. Arrange the following list of eukaryotic gene elements in the order in which they would appear in thegenome and in the direction traveled by RNA polymerase along the gene. Assume the gene’s singleintron interrupts the open reading frame. Note thatsome of these names are abbreviated and thus do notdistinguish between elements in DNA versus RNA.For example, splice-donor site is an abbreviation forDNA sequences transcribed into the splice-donor sitebecause splicing takes place on the gene’s RNA transcript, not on the gene itself. Geneticists often usethis kind of shorthand for simplicity, even thoughit is imprecise. (a) splice-donor site; (b) 3′ UTR;(c) promoter; (d) stop codon; (e) nucleotide towhich methylated cap is added; (f) initiation codon;(g) transcription terminator; (h) splice-acceptorsite; (i) 5′ UTR; (j) poly-A addition site; (k) splicebranch site. Concerning the list of eukaryotic gene elements inProblem 34:a. Which of the element names in the list are abbreviated? (That…
The RNA polymerase from bacteriophage T7 diff ers structurally from prokaryotic and eukaryotic RNAPs and is extremely specifi c for its own promoter. Why do these properties make T7 RNAP useful in experiments with recombinant DNA?
mRNA sequence of A gene Write the amino acid sequence of the gene A. 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’
(a-32P) GMP INCORPORATED (pmol) N 111 (a) (b) (c) 20 5 (min) 26 10 The image above shows an experiment to investigate the effect of TFIIS on transcription by RNA polymerase II. Why were NTPs added to the reaction last?
5. The following DNA nucleotides are found near the end of a bacterial transcription unit. 3-AGCATACAGCAGACCGTTGGTCTGAAAAAAAAGCATACA-5' Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form. a. b. Suppose that the string of A nucleotides following the inverted repeat in a rho-independent terminator were deleted but that the inverted repeat was left intact. How will this deletion affect termination? What will happen when RNA polymerase reaches this region?