DNA Replication Transcription No Answers Chosen No Answers Chosen Translation Common to all three No Answers Chosen No Answers Chosen Possible answers ! Okazaki Fragments E Start Codon | DNA Polymerase ! Guanine | Cytosine | Thymine | 5' Cap ! Helicase | Uracil | RNA Polymerase E Introns | Ligase | Exons | Adanine | Aminoacyl RNA synthetase | Gyrase | TRNA | Ribosome | RNA Splicing | Poly-A Tail I Promoter I RNA Primer I Stop Codon | Exonucleases

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________
The template strand of a double helical segment of DNA consists of the following sequence: 5’- GTAGCCTTATCTAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACCATGTATAGTTG-3’ Use the given data to answer the succeeding questions and always indicate (and pay attention to) the DIRECTIONALITY of the strands in your answers. Part I. What is the nucleotide order in the complementary DNA strand? Part 2. What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? Part 3. What will be the overall anticodon sequence in tRNA? Part 4. Following the transitional process, what is the amino acid sequence that will be coded for? Show your answer using ONE-letter amino code starting from N-terminus to C-terminus Part 5. Following translational process, what is the amino acid sequence that will be coded for? Show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus.
he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′
Let’s return to your patient with sickle cell anemia. Below is the RNA sequence from your patient and from her mother. (The ••• represents another 30 nucleotides not written out here). The affected nucleotide is indicated in BOLD. Patient’s RNA: 5’ –CUAUGACAGAGUUC•••CAUUAGCCA – 3’ Mother’s RNA: 5’ –CUAUGACAGUGUUC•••CAUUAGCCA – 3’ A) Write out the first 10 nucleotides corresponding to the DNA sequence of the coding strand for your patient in the 5' to 3' direction. B) From the information you have been given, why is it not possible to accurately write out the DNA sequence as it would really be found in the genome? (ie, what you wrote down in part A is NOT necessarily what the DNA sequence would really look like if we could examine the chromosome directly - why? And no this has nothing to do with the 30 nucleotides that aren’t written out or the mutated base). Your answer should be 1-2 sentences maximum.
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
Deoxyribonucleoside triphosphates are the necessary and fundamental monomers for polymerization of DNA. However, DNA replication also requires ribonucleoside triphosphates. Why? More than one answer is correct. Question 8 options: new DNA chains are initiated on an RNA primer synthesized from ribonucleoside triphosphates by primase. DNA helicase uses the energy of ATP (a ribonucleoside triphosphate) to unwind the DNA double helix before DNA synthesis can occur. unlike DNA polymerase epsilon, DNA polymerase delta incorporates ribonucleotides into the growing polymer to synthesize the lagging strand ribonucleoside triphosphates are converted into deoxyribonucleoside triphosphates by DNA polymerase immediately before incorporation. DNA is first synthesized as RNA which is converted to DNA by removal of the 2'-OH (2' hydroxyl) from the pentose sugars in the backbone by DNA polymerase.
Please answer both question.its all a one question.otherwise I will give downvote. Below is a double strand DNA sequence contain a gene and it will go under transcription, suppose that the 3/ → 5/ is the template strand: 3/-TAC-GAC-CGT-TGG-CTT-CTG-TGT-AGG-TAT-ACC-GAT-ACT-5/ 5-/ATG-CTG- GCA-ACC-GAA-GAC-ACA-TCC-ATA-TGG-CTA-TGA-3/ 1- Write down the mRNA transcript with direction of ends of the strand? 2- Construct the resulted polypeptide chain from translation of the mRNA above based on the following codons translation below AUG: Methionine GCA: Alanine ACC: Threonine UGA: write its name GAA: Glutamic acid GAC: Aspartic acid CUG: Leucine ACA: Threonine UCC: Serine AUA: Isoleucine UGG: Tryptophan CUA: Leucine
match these replication associated terms with the appropriate definition or function. DNA polymerase primase ligase helicase orgin did i do it correctly?
A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…
DNA Replication Explanation Must Include (no essay) Leading strand with 5' and 3' Lagging strand with 3' and 5' - Okazaki fragments Bases (following the base pairing rule) Primase -Primer helicase Polymerase Ligase Parent Strands Daughter Strands New DNAs - semiconservative