Q: Question #14
A: Cell cycle is the sequential steps that divides the cell into two or more daughter cells. The four…
Q: 5. Assume that you are trying to do a gel mobility shift experiment using a normal set of Trp genes.…
A: The gel mobility shift assay is a biochemistry technique used to detect protein complexes with DNA.…
Q: 1. a)What would happen if the aminoacyl tRNA synthetase responsible for charging alanine tRNAs also…
A: The polymerization of amino acids according to the codons on mRNA to form proteins is known as…
Q: elomere position effect (TPE) alters the gene expression in yeast cells? why?
A: Transcription and replication of adjacent DNA is affected by telomere.telomeres also impose an edge…
Q: . a. Mice engineered to block expression of the geneencoding the telomerase protein age at a…
A: Telomerase is an enzyme that is essential for the replication of chromosomal ends. It is a…
Q: 12. a. You want to create a genetic construct that will express GFP in Drosophila. In addition to…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: If telomeres are normally shortened after each round of replication in somatic cells , what…
A: Dolly, the sheep, was a matchless feat in animal biotechnology and cloning. she was born of a finn…
Q: In yeast cells, telomerase remains active and maintains telomeres of about 300 base pairs. Propose…
A: Telomeres play a very important role in preserving our genome information.
Q: Fig 3.16 EcoRI SacI Kpnl ampR Aval Xmal Smal lacZ BamHI Xbal Sall AccI HincII PstI Sphl HindIII Bam…
A: A bacterial protein termed restriction enzyme, also known as molecular scissors, cleaves DNA at…
Q: 5. The downstream process for a recombinant protein begins with 100 liters of clarified lysate. At…
A: Protein purification is series of processes to isolate one or few proteins from a complex mixture of…
Q: Telomeres contain a 3′ overhang region, as shown. Does telomerase require a 3′ overhang to replicate…
A: Telomeres are protein complexes placed at chromosome ends. The specific telomere structure covers…
Q: 5.If the following two primers 3'AAGS' S'CCG3' were used to facilitate the polymerase chain reaction…
A: Deoxyribonucleic acid (DNA) refers to the polymer that is made of nucleotides. A nucleotide…
Q: Given the fact that 1 fg of DNA = 9.78 * 105base pairs (on average), you can convert the amount of…
A: Hi! Thank you for your question. We need to know the duration of the S phase to answer the second…
Q: D C 5' 3¹ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F)…
A: Transcription is the process by which mRNA is synthesized from DNA. Translation is the process of…
Q: Draw the structure of the double Holliday junctionthat would result from strand invasion by both…
A: Holiday junction are intermediates of homologous recombination and this junction formation occur…
Q: Immortality of Stem cells is supported by the expression of telomerase that can extend the telomere…
A:
Q: Show the expected labeled cleavage products if the following DNA segment were subjected to each of…
A: D.N.A. Cleavage --- A cleavage of single - stranded DNA oligonucleotides in the presence of ionic…
Q: Hydroxylamine (HA) causes only G • C → A • T transitions in DNA. Will HA produce nonsense mutations…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: . A mutational lesion results in a sequence containing amismatched base pair:5′ AGCTGCCTT 3′3′…
A: Mismatch repair : It is a system for recognizing and repairing wrong insertions, deletions and…
Q: A sample of liver cells was collected from a healthy donor and from an individual with liver cancer.…
A: Gene regulation involves the expression of certain genes at a time out of all the genes present in…
Q: What is NOT a way to test the requirement of ylg (your favorite gene) in heart development? OA…
A: *yfg is called as Your Favorite Gene which is an dynamic web based research which Base, a repository…
Q: A number of yeast-derived elements were added to thecircular bacterial plasmid pBR322. Yeast that…
A: Genomics contains an important technique by which multiple and exact copies of a gene can be…
Q: 2. a. You want to create a genetic construct that will express GFP in Drosophila. In addition to the…
A: Green fluorescent protein (GFP) contains 238 amino acids which are responsible for bright green…
Q: Bob's telomerase works extremely well (10x better than the average humans). Explain the function of…
A: Telomerase is an enzyme. It maintains length of telomere by adding repetative sequence that are…
Q: What type of chromosomal rearrangement occurs when o Crossovers between repeats of the same sequence…
A: Chromosomal rearrangement comprises of 4 types: deletion, duplication, inversion, translocation.…
Q: Given: BamHI, cleaves after the first G: 5’ G GATCC 3’ 3’ CCTAG G 5’ AND BclI cleaves after the…
A: DNA-cutting enzymes are restriction enzymes. Each enzyme recognises a single or a few target…
Q: O A. Screen thousands of strains for a spontaneous unc-22 mutation O B. Soak worms in mutagenic…
A: In RNA silencing microorganisms are used to silence or negatively affect the gene expression. It is…
Q: For your 25ul ligation reaction: You need to add 160ng of your digested insert DNA (which is at a…
A: Given: Total volume - 25ul. The DNA need to be added is 160 ng. One ul contains 160 ng of digested…
Q: Which of the following is true about the enzyme telomerase? A. It is found only in adult cells.…
A: Telomeres are the ends of the linear chromosomes.
Q: yeast cells, telomerase remains active and maintains telomeres of about 300 base pairs. Propose what…
A: The end areas of chromosomes are called telomeres , are repetitive sequence that protect gene from…
Q: ow that the human genome has been sequenced, we know that there are fewer than expected protein…
A: The genomes of most eukaryotes including Humans are larger and complex than those of prokaryotes.…
Q: Under physiological conditions, DNA ordinarily formsB-DNA. However, RNA hairpins and DNA-RNAhybrids…
A: DNA and RNA are the biomolecules that are responsible for carrying genetic information in all living…
Q: IK Comans Caselm) are shOwn in the following document: Codon Number Base Sequence of Normal DNA…
A: The base sequence of a normally transcribed strand is given as follows, TAC TCC CTC AAT CTT AAT TTG…
Q: Some viruses, like SV40, are closed circular DNAS carrying nucleo- somes. If the SV40 virus is…
A: Topoisomerases are enzymes that participates in the overwinding or underwinding of DNA. The winding…
Q: How might the knowledge in telomeres and telomerase be applied to anti-aging strategies? Are such…
A: To find The nature of telomere genetic material How telomere is applied to anti-aging Is strategy…
Q: 1.Your goal is to design a strategy to create thisfinal pDHFR plasmid for fusion protein…
A: Vectors are DNA molecules that act as transporting vehicle which carries foreign DNA into a host…
Q: hat are possible outcomes following DNA cleavage by Cas9? O Disruption of a gene O Insertion of a…
A: The CRISPR-Cas9 system disrupts a gene on its own. The reason for this is, after the cleavage of…
Q: I only need letter D
A: Deoxy ribonucleic acid (DNA) is the genetic material that contains genetic material in the form of…
Q: 5' - ATGGCGAGGCGGCAGCTGTTATGGTGA – 3' In the sequence above, suppose that the 20th nucleotide of the…
A: The mRNA is produced from the template strand that is oriented in 3' to 5' direction and the newly…
Q: Consider the mechanism of the enzyme RNase: What would happen to the Km (i.e., would it…
A: The Km is the Michaelis constant, which is the substrate concentration at which velocity is half of…
Q: Cancer cells must be able to proliferate indefinitely. Therefore, many inappropriately express…
A: Cancer cells are cells that divide relentlessly, forming solid tumors, or flooding the blood with…
Q: The ends of the linear chromosomal DNA are protected from degradation and gradual shortening by the…
A: The hereditary unit of the life is the genes. These genes are present in a long thread like…
Q: 2) A few years ago, a graduate student in my lab realized that a DNA construct in which he fused the…
A: The recombinant fusion protein can be constructed using the component proteins and linker. The…
Q: Chromatin remodeling by the SWI /SNF complex requires hydrolysis of ATP. What purpose does this…
A: ATP-dependent chromatin remodeling complexes i.e. SWI /SNF complex are specific machinery that can…
Q: 6. Given: 3--TACTTCAAACCGGGCCCGATT--5 a) Give the sequence of nucleotides in the mRNA. b) What is…
A: The DNA is translated into mRNA by transcription process and then the mRNA is translated into…
Q: 6. Mutation analysis of GCK gene in patients with diabetes revealed a c.114 T>A (shown in bold and…
A: Restriction enzyme binds to the recognition sequence in the DNA. It is responsible for cutting the…
Q: explain the process of homology-dependent repair?
A: All living organisms are made up of cell. It can be either unicellular organism or multicellular…
Q: BamHI, cleaves after the first G: 5’ G GATCC 3’ 3’ CCTAG G 5’ Does cleavage by BamHI result in a…
A: Given: Sequence: 5’ G GATCC 3’ 3’ CCTAG G 5’ BamHI, cleaves after the first G.
Q: What base-pair substitution would 5-bromouracil generate?
A: DNA has a nucleotide sequence which is important for gene expression and information storage. The…
BclI cleaves after the first T:
5’ T GATCA 3’
3’ ACTAG T 5’
Does cleavage by BclI result in a 5’ or 3’ overhang? What is the sequence of this overhang?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- BamHI, cleaves after the first G: 5’ G GATCC 3’ 3’ CCTAG G 5’ Does cleavage by BamHI result in a 5’ or 3’ overhang? What is the sequence of this overhang?Given: BamHI, cleaves after the first G: 5’ G GATCC 3’ 3’ CCTAG G 5’ AND BclI cleaves after the first T: 5’ T GATCA 3’ 3’ ACTAG T 5’ THEN -- Given the DNA shown below: 5’ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG3’ 3’TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC5’ i) If this DNA was cut with BamHI, how many DNA fragments would you expect? ii) If the DNA shown above was cut with the enzyme BclI, how many DNA fragment would you expect?Show the expected labeled cleavage products if the following DNA segment were subjected to each of the four cleavage reactions: 32P-A-A-C-A-T-G-G-C-G-C-T-T-A-T-G-A-C-G-A
- Which statements are true? Explain why or why not.1 In terms of the way it interacts with DNA, thehelix–loop–helix motif is more closely related to the leu-cine zipper motif than it is to the helix–turn–helix motif.2 Once cells have differentiated to their final spe-cialized forms, they never again alter expression of theirgenes.3 CG islands are thought to have arisen during evo-lution because they were associated with portions of thegenome that remained unmethylated in the germ line.4 In most differentiated tissues, daughter cells retaina memory of gene expression patterns that were presentin the parent cell through mechanisms that do not involvechanges in the sequence of their genomic DNA.Assume the following DNA template strand: 3'-ATA GCG AGG AGT ATC-5' A) What would be the protein associated with this DNA template strand? Give the sequence of amino acids encoded by this fragment. Leave traces of your steps. B) In the synthesis of this protein, what are the codon and the anticodon for? Explain in one sentence for each. C) We find, in another cell, a mutation of this DNA template strand: 3' ATA GCG TGG AGT ATC-5’ 1. What type of point mutation is it? 2. Did this mutation arise during transcription, translation or DNA replication? D) If this mutation is found in a spermatozoon, will it have an effect on the individual, its offspring or both? Briefly explainFour cosmid clones, which we will call cosmids A, B, C, and D, werehybridized to each other in pairwise combinations. The insert size ofeach cosmid was also analyzed. The following results were obtained:
- A diploid human cell contains approximately 6.4 billion base pairs of DNA. Q.How many histone proteins are complexed with this DNA?Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?IPSCs are nearly identical to human embryonic stem cells in terms of gene expression, but there may be other ways in which they are not equivalent. For example, the telomeres of IPSCs often vary in length, with many IPSCs cells having telomeres shorter than those of embryonic. How might shortened telomeres affect the life-span of IPSCs or of differentiated cells derived from them?
- Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram the recombinational event leading to the formation of a heteroduplex DNA region within a bacteriophage chromosome.Multiple Replication Forks in E. coli I Assuming DNA replication proceeds at a rate of 750 base pairs per second, calculate how long it will take to replicate the entire E. coli genome. Under optimal conditions, E. coli cells divide every 20 minutes. What is the minimal number of replication forks per E. coli chromosome in order to sustain such a rate of cell division?Multiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram illustrating replication of the circular E. coli chromosome (a) at an early stage, (b) when one-third completed, (c) when two-thirds completed, and (d) when almost finished, assuming the initiation of replication at oriC has occurred only once. Then, draw a diagram showing the E. coli chromosome in problem 3 where the E. coli cell is dividing every 20 minutes.
