The consensus sequence comprises the most commonly encountered nucleotides at each site. (5'-T ATAAAA G-3' 5'-T CCAATG C-3' sequences 5'-A ATAGCCG-3' 5'-T ACAGGAC-3' -5'-T AYARNA %-3' Actual Consensus sequence This notation Pyrimidines are indicated means cytosine and guanine are equally common. by Y. Purines are indicated by R. N means that no particular base is more common.

The consensus sequence comprises the most commonly encountered nucleotides at each site. (5'-T ATAAAA G-3' 5'-T CCAATG C-3' sequences 5'-A ATAGCCG-3' 5'-T ACAGGAC-3' -5'-T AYARNA %-3' Actual Consensus sequence This notation Pyrimidines are indicated means cytosine and guanine are equally common. by Y. Purines are indicated by R. N means that no particular base is more common.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 2P

See similar textbooks

Similar questions

For the following five sequences, what is the consensus sequence? 5′–GGGAGCG–3′ 5′–GAGAGCG–3′ 5′–GAGTGCG–3′ 5′–GAGAACG–3′ 5′–GAGAGCA–3′ a. 5′–GGGAGCG–3′ b. 5′–GAGAGCG–3′ c. 5′–GAGTGCG–3′ d. 5′–GAGAACG–3′
Codon-Anticodon Recognition: Base-Pairing Possibilities (Integrates with Chapter 11.) Draw base-pair structures for (a) a G:C base pair. (b) a C:G base pair. (C) a G:U base pair, and (d) a U:G base pair. Note how these various base pairs differ in the potential hydrogen-bonding patterns they present within the major groove and minor groove of a double-helical nucleic acid.
Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.
Design a primer pair using NCBI Primer-BLAST for gene RNA 2',3'-cyclic phosphate and 5'-OH ligase (RTCB) (Homo sapiens); with accession number NM_014306.5. Fill in the following table with the details of the designed primer pair. Please share the graphical report and detailed report screen shot for the selected primer pair. Please write the primers sequence:
Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
The following diagram illustrates a step in the process of translation. Identify the following elements on the diagram. a. A, P, and E sites
In the given segment 3 ’ C A G T T A C G G C T C C T A G G T T A T A A T T C G T T T C 5 ’ Illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragment
5' ACTGAGGATTCGGACAGCAATAGGATG 3' When translated, the -1 reading frame of the sequence above gives the following amino acid sequence: HPIAVRILS What triplet of nucleotides (in other words, what DNA codon) represents the amino acid "P" (proline)? a) 5' GTA 3' b) 5' CAT 3' c) 5' CCT 3' d) 5' ATC 3'
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF?
What would be the most likely effect of moving the AAUAAAconsensus sequence shown in Figure 14.7 10 nucleotides upstream?
Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr
Hello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.