Function of Endonucleases Enhancers To bnd out antbiotic resstance Cut D Aat specitic DNA
Q: posite shows the standard (coding strand) for the 20 amino acids involved in protein r DNA template…
A: DNA is the genetic material present in the cell.
Q: MRNA HRNA Topoisomerase DNA gyrase Sense strand Bubble Promoter region Antisense strand Coding…
A: Central dogma means the flow of genetic information in the cell. It states that the 3 main process…
Q: ........ cen not be true about in ditu hybridization. Use to reveal where gene expressed at mrna…
A: In-situ hybridization spots specific nucleic acid sequences within intact chromosomes, eukaryotic…
Q: he enzyme used in the formation of cDNA from mRNA isa) Polymeraseb) Helicasec) Reverse…
A: In gene cloning, the chromosomal DNA and vector DNA are used to get multiple copies of genes. The…
Q: Polyadenylation signal sequence is present in Termination region 3'UTR O Poly(A) tail All of the…
A: In eukaryotes the process of polyadenylation involves the addition of a poly(A) tail to a mRNA…
Q: a. The promoter is to the right so transcription goes right to left. b. This sequence 5’…
A: Transcription is is a cellular process by which DNA can produce RNA by the use of RNA polymerase…
Q: Removal of introns requires a poly-A tail. O a 5' cap. ORNA polymerase enzymes. curling to the…
A: Introduction :- Any nucleotide sequence within a gene that is eliminated during RNA processing to…
Q: intron-Seauence of nueleotides klith in the gene but are r emeved fürm the Ŝeaçuente a final MKNA…
A: Ribonucleic acid (RNA) modifications refers to alteration in the chemical composition of ribonucleic…
Q: Process Purpose Beginning Point Ending Point Replication Origin or end of molecule…
A: The conversion of DNA to RNA and finally resulting in the production of proteins is called central…
Q: EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA…
A: A missense mutation is a mistake in the DNA which results in the wrong amino acid being incorporated…
Q: Where does RNA polymerase bind DNA?a) Promoterb) Operatorc) Enhancerd) None
A: The DNA is the genetic material that is passed from one generation to the next generation. It is…
Q: What type of molecule or cell is PGLO? C Origin region Arabinose operon arac ori Ndel Promoter PAD…
A: The green fluorescent protein (GFP) is a protein that exhibits bright green fluorescence when…
Q: Match the term with its description.
A: There are various enzymes and gene components that are studied in techniques of genetic engineering.…
Q: 38) Termination begins when there is an AUG at the A site begins with a termination codon…
A: Termination is the final step in the translation process. When a stop codon (UAA, UAG, or UGA) in…
Q: The main function of t-RNA isa) Proof readingb) Inhibits protein synthesisc) Identifies amino acids…
A: Transfer RNA, also known as soluble RNA is an adapter molecule that is composed of 76 to 90…
Q: Exonucleases can digest the poly A tail of eukaryotic mRNAs in the 3' to 5' direction which thereby…
A: Transcription is a process through which the template strand of DNA gets transcribed into mRNA. In…
Q: The diagram below shows a section of double-stranded DNA undergoing both transcription and…
A: DNA replication is the process in which the DNA copies are made by the action of several enzymes…
Q: The purpose of site-directed mutagenesis and CRISPR-Cas technologyis toa. determine if a protein…
A: Site-directed mutagenesis is a technique that produces mutation within a specific site in the cloned…
Q: Record the type of mutation obtained for the mutagens. Mutagen Alkylator. Was it point, addition,…
A: Mutagens are physical or chemical agents that induce mutation in the DNA (deoxyribonucleic acid).…
Q: A mutagen that is a base analog isa. ethyl methanesulfonate (EMS).b. 5-bromouracil.c. UV light.d.…
A: The DNA is a genetic material- a polynucleotide chain made up of the long chain of A, T, G, and C.…
Q: Site directed mutagenesis facilitated research ona) Carbohydratesb) Proteinsc) Lipidsd) Fats
A: Site-directed mutagenesis is a technique of molecular biology that involves the induction of…
Q: The RISC complex contains: Dicer Argonaute RNAse HI DNA
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Following is the nucleotide sequence in a segment of a strand of DNA 5'- AATTGGCTCTATAAT-3' Give the…
A: Adenine, thymine, guanine, and cytosine are the bases of the DNA. The mRNA is a single-stranded…
Q: The ___ precedes/senses the start of a gene; and therefore, it is the sire where RNA polymerase…
A: Transcription is defined as the copying a gene's DNA sequence to make an RNA molecule. RNA…
Q: Cas9 endonuclease can be targeted to specific sequences in the genome using a OA. PAM site O B.…
A: Answer:- Option B is the correct choice. Cas9 endonuclease is a bacterial RNA-guided substance It…
Q: pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to…
A: Gene is a part of the DNA, located on a specific site on the chromosome and has a specific sequence…
Q: anatomical distribution of gene expression can assessedby...... in situ hybridization rnai…
A: A northern blot is a lab technique for detecting individual RNA molecules in a mixture of RNA…
Q: Synthesis of hybrid genes can occu Directed mutagenesis O Using overlap primers O RT-PCR
A: PCR technique of amplification of a given molecule of DNA using taq polymerase enzyme.
Q: Some events that may occus during transcription 1. RNA polymerases detach 2. DNA polymerases…
A: Introduction DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…
Q: Addition or deletion of bases causes which kind of mutation? Select one: O a. Transversion O b. •…
A: Any heritable change that happens in the nucleotide sequence of the DNA is called a mutation.…
Q: 18. In order to m protein. You crea guide RNA comp sequence Gene that the CRISPR Gene Yis neces: a.…
A: CRISPR/ cas 9 Clustered regularly interspaced short palindromic repeats is a gene editing system…
Q: Frameshift mutations can be caused by: strand slippage. O deletions. depurinations. intercalating…
A:
Q: sigma factor: TFIID TBP as O Pribnow box: TATA box O RNA polymerase holoenzyme: RNA polymerase II…
A: Sigma factor is a protein essential for the initiation of transcription in bacteria.It enables…
Q: • Retrotransposons move via an ___ intermediate thatis converted by reverse transcriptase into a…
A: Gene is the basic functional unit of heredity. A gene is a sequence of nucleotides in genome that…
Q: A mature transcr Select one: a. 5' UTR b.introns С. ехons O d. Poly A ta e. guanine f.3' UTR
A: The 5′ untranslated region is the region of an mRNA that is directly upstream from the initiation…
Q: = exons = introns Transcription termination site (also poly A site) Promoter Start of transcription…
A: Transcription is the process which consists of several steps of DNA-based gene expression. Here a…
Q: Resection of a bacterial chromosome in which genes for the enzymes of of a particular metabolic…
A: Genetic information is inherited to generations by means of DNA. The DNA has many genes that code…
Q: The processing of ribosomal RNA in eukaryotes is shown . Why is this called cleavage or processing…
A: Transcription is the first step in gene expression during which the nucleotide sequence of DNA is…
Q: Which transposable element is used to introduce foreignDNA into the fruit fly Drosophila…
A: A transposon is a piece of DNA that can be transported from a plasmid to a chromosome, or…
Q: GAC TATGCGGGA GGT GAAGCC ATGA would happen If fourrt A in the given sbrand mutated to t 2 And in…
A: Mutations are changes in the DNA sequence that occurs as a result of errors in the DNA copying…
Q: Both transposase and integrase cleave the target DNA at staggeredsites before the TE is inserted.…
A: The transposable elements are DNA (deoxyribonucleic acid) sequences that migrate from one location…
Q: 5'.GTCTCTTGACATTG... 3' What is the MRNA sequence transcribed from this sequence (assume the…
A: Ans ) Always Guanine codes for cysteine only .. That is G-C Given.…
Q: Sene edits can be made to Eukaryotic DNA by using a complex composed O Progenitor cell and 4 master…
A: Gene editing is a group of technologies that give scientists the ability to change an organism's…
Q: Antisense RNA If MRNA is produced using this plasmid, what changes would result in production of an…
A: The antisense or asRNA is the transcript that is complementary to the mRNA. It is used to silence…
Q: Describe three possible uses of site-directed mutagenesis.
A: Site-directed mutagenesis is to understand which gene is responsible for the desired trait.
Q: What are post transcriptional modifications? Write down their importance Write in detail in ur own…
A: In eukaryotes, the transcription of DNA occurs in the nucleus of the cell, which yields the primary…
Q: Matching type Choices are in the picture 6. RF1 and RF2 recognize the three bases to terminate the…
A: Transcription is the process in which the DNA molecule information is copied into RNA molecule. The…
Step by step
Solved in 2 steps
- The amount of DNA inintronic regionof genes can be grwater than the amount of DNA in exons. trueIf a person os homozygous for the presence of an ALU repeat in the PV92 region you would expect the size of the DNA fragment to be compared to those whith no ALUrepeatsHere's a line of DNA code: TACACGCCAGAG Transcribe it: (USE caps, no spaces)
- COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGCWhat Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. FluxomeThe original DNA sequence TACACCTTGGCGACT I need the mRNA sequence and the amino acid sequence And also the mutation type
- Promotor region of a gene contains start codon and exon one. TRUE OR FASLE ASAP I LL RATE NO EXPLANATION NEEDEDPLEASE FL OUT TABLE USING INSTRXUTIONS -USE BASE PAIRING RULES TO COMPLETE SECOND COLUMN FOR EACH MUTATION WRIYE IN ANY MRNA DOEONS RHAT WILL BE FHANGED AS THE REEULR OF RHE MURATION AND USE X MARKS RO INDÍCATE DOONS THAT WONT BE FHANGES CIRCLE STOP CODONSGive the mRNA and amino acid sequence from this DNA strand: CCATTAACCTTACTGCTGGCTAAATTCGTTGCT
- Chromosomal ____________include those that removeor add base pairs (deletions and duplications), and thosethat relocate DNA regions (inversions and translocations).Enter the corresponding section of mRNA produced feom the following sections of a DNA template strand: G C G A A T G A C C A TBase on the coding strand of DNA: ATG GGA ATT CGC What is the sequence of the complementary template strand of DNA that pairs with the coding strand?
