In depth please i don't know anything about this its just the translation bit why im i seeing a Y that's not AUTC of bases? Explain translation more depth Junctic code isLiplain why the genetic code is degenerate.(iii) Explain how the code being degenerate is[2][2][1](d) Why is the genetic code described as universal (or near-advantageous to living organisms.by[5]14]universal)?[1][Total: 11]DNA triplet codesTTTTTCamino acidTTAphenylalanineCTGTTGCTTСТССТАATTATCАТАleucineGTTGTCGTAisoleucineGTGvalineTCTTCCTCATCGAGTAGCserineССТСССССАСCGprolineАСTACCACAACGthreonineGCTGCCGCA GCGalanineTATТАСtyrosineCATCAChistidineCAACAGglutamineasparaginelysineaspartic acidglutamic acidAATAACAAAAAGGACGAGGATGAAcysteinetryptophanarginineglycineTGTTGCTGGCGA CGG AGA AGGCGT CGCGGA GGGmethionineGGT GGCATG10. The following questions relate to transcription and translation.(a) Describe the process of transcription.the process of translation.TAGTCATAA(5](5] . The table opposite shows the standard (coding strand) DNArinlet codes for the 20 amino acids involved in protein synthesA section of DNA template strand is shown below.5'-CATCCAAATTGTTGCCCG-3'(a) Write down the sequence of amino acids formed when tsection of DNA is transcribed and translated.(b) The standard (coding strand) base triplets TAA, TAG arTCA do not correspond with an amino acid.)Write down the corresponding MRNA codons for tbase triplets.

DNA is the genetic material present in the cell.

posite shows the standard (coding strand) for the 20 amino acids involved in protein r DNA template strand is shown below. AATTGTTGCCCG-3' wn the sequence of amino acids formed f DNA is transcribed and translated. dard (coding strand) base triplets TAA, T mot correspond with an amino acid. e down the corresponding mRNA codo triplets.

posite shows the standard (coding strand) for the 20 amino acids involved in protein r DNA template strand is shown below. AATTGTTGCCCG-3' wn the sequence of amino acids formed f DNA is transcribed and translated. dard (coding strand) base triplets TAA, T mot correspond with an amino acid. e down the corresponding mRNA codo triplets.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

3. (i) Referring to the genetic code (the codon usage table), what would be the amino acidsequence of the polypeptide encoded by the following mRNA sequence?5’ AUGGUGGCCUAUCAUUAGGGGCUU 3’(ii) What would be the effect on translation of the above sequence of a single base (point)mutation which gave rise to an A instead of a U at the twelfth base?(iii) What would be the effect on translation of the sequence in (i) above, if an extra Cwere inserted between the third and fourth bases, i.e., between the two Gs at position 3and 4?
From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' Using ONE-letter amino acid code starting from N-terminus to C-terminus, what is the amino acid sequence that will be coded for?
Give typing answer with explanation and conclusion 5'ATTAGGAGGTGCGTTATGCAGGCATGTTACGTACGTACG,TAAGATAAGTACT3’ 3' TAATCCTCCACGCAATACGTCCGTACAATGCATGCATGCATTCTATTCATGA5’ In the above piece of double stranded DNA, how many potential translations start sites exist if an mRNA could be synthesized from any portion of this DNA? Indicate where they are in the DNA above and explain how you found this number.
To create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3', design the corresponding RNA sequence. Indicate the sequence in a 5' to 3' manner. What type of helix (A, B or Z) will this double-stranded nucleic acid form?
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… d) Assuming the sequence above is a bacterial gene, identify the region encoding the Shine-Dalgarno sequence. e) What is the function of the shine Dalgarno sequence?
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′
A fragment of bacterial DNA reads: 3’ -TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would he transcribed? (Hint: Be sure to identify the initiation site.)
If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to the DNA nontemplate strand, then why are base sequences of mRNA and the DNA nontemplate strand not identical? Could they ever be?
Contrast transcription and translation. Name at least three differences between the two processes.
Helicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins, and papilloma virus El helicase (illustrated in Figures 16.22 to 16.25), unwind DNA by passing one strand of the DNA duplex through the central pore, using a mechanism based on ATP-dependent binding interactions with the bases of that strand. The genome of E. coli K12 consists of 4,686,137 nucleotides. Assuming that DnaB functions like papilloma virus El helicase, from the information given in Chapter 16 on ATP-coupled DNA unwinding, calculate how many molecules of ATP would be needed to completely unwind the E. coli K 12 chromosome.
Consequences of the Wobble Hypothesis Point out why Cricks wobble hypothesis would allow fewer than 61 anticodons to be used to translate the 61 sense codons. How might wobble tend to accelerate the rate of translation?
1- Biochemist Erwin Chargaff was the first to note that, in DNA, [A] = [T] and [G] = [C], equalities now called Chargaff’s rule. With the use of this rule, determine the percentages of all the bases in a DNA molecule which contains 35% thymine. Explain. 2- Similar equalities (i.e. [A]=[U] and [G]=[C]) are however not observed in RNA molecules. Explain the structural differences which dictate why Chargaff rule does not apply to RNA polynucleotides.