Genetics question about COVID-19.what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? (how did you determine the actual sequence?) 4. Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation:(A)(C)SpikeNucleocapsidMembraneS1 subunitS2 subunitEnvelope614RNA viral genomeNTDRBDFPHR1HR2 TM CT(B)Binding site to ACE2receptor in human cellsN terminaldomain$1FusionHR2proteinS2Transmembranedomain andcytoplasmic tailTrends in Geneticsa) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614(that's why it's called the D614G mutant) in the S1 subunit of the Spike protein. Using onlythe information above and a codon table, what are the mRNA codon sequences of the2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5' to 3' orientation

The currently dominant variant of SARS-CoV-2 (severe acute respiratory syndrome-coronavirus 2)…

Answered: Genetics question about COVID-19. what…

Genetics question about COVID-19. what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? (how did you determine the actual sequence?)

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter1: Introduction To Biological Concepts And Research

Section: Chapter Questions

Problem 11TYK

See similar textbooks

Related questions

Q: reduction in histone acetylation and reduced gene transcription. Given this information, which of…

A: Transcription is a highly controlled process and it requires the presence of enzymes polymerase and…

Q: Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the…

A: Translation is the process which is responsible for synthesis of protein from the mRNA.

Q: Question #14

A: Cell cycle is the sequential steps that divides the cell into two or more daughter cells. The four…

Q: Synthesize a Protein 5. Below is a region of a gene. Transcribe the gene into a pre-mRNA strand. DNA…

A: In this question, we have to answer the mRNA sequence , processing of mature RNA and peptide chain…

Q: Question:- Which statement below about gene expression is TRUE? A. Transcription initiation begins…

A: A gene is a part of DNA that codes for a particular protein. Each Jean carries a particular set of…

Q: Histones are thought to be displaced as RNA polymerase is transcribing a gene. What would the…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: Histones : MOLECULAR BIOLOGY_advanced are basic proteins. carry an epigenetic code similar…

A: Histones are strongly alkaline proteins with a lot of lysine and arginine residue which are present…

Q: give the codon sequences of every code on this tRNA with the anti-codon 5AAG3, could pair with…

A: tRNA are transfer RNA which are responsible for decoding the information on mRNA for the synthesis…

Q: I NEED HELP SOLVING THIS CONCEPT MAP ON PROTEIN SYNTHESIS.

A: Protein synthesis is the process where biological cells generate new proteins.

Q: elelgmst AMO 3. The following mRNA strand is being used to assemble a polypeptide strand by a noit…

A: Given: An mRNA strand is given and we need to find A. Respective amino acid sequence. B. Alternative…

Q: 2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation…

A: DNA(deoxyribonucleic acid) is the genetic material in all the organisms except few viruses. The…

Q: The gel below is the result of a Sanger sequencing run of part of Exon 3 of the Mstn gene, which…

A: In Sanger sequencing, the objective is to analyze the sequence of a given strand of DNA. To obtain…

Q: The gel below is the result of a Sanger sequencing run of part of Exon 3 of the Mstn gene, which…

A: Given: A gel. This gel shows the result of a Sanger sequencing run of part of Exon 3 of the Mstn…

Q: o In Prokaryotes, what is the function of the 5'UTR? A. It contains the start codon It contains the…

A: The 5′ untranslated region (5′ UTR) is the region of an mRNA that is directly upstream from the…

Q: mRNA: 5’ – UGAUCAUGAUCUCGUAAGAUAUC – 3’ -Draw a box around the sequence where protein synthesis…

A: CENTRAL DOGMA:- The whole process of Central Dogma involves two processes:- 1) When DNA changes into…

Q: Be sure to answer all parts. Consider the following mRNA sequence: 5'-GCU AGG CGA-3'. a. What amino…

A: Translation is the process in which the m rna is converted into a polypeptide chain of amino acids…

Q: xplain The mRNA codon of valine is: GUC UGG CCA TTG

A: Each codon in mRNA is made up of three nucleotides and represents a certain amino acid (hence, it is…

Q: Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code…

A: DNA or deoxyribonucleic acid undergoes transcription and produces messenger RNA sequence in the form…

Q: 1b) Give the anticodon of the tRNA that would be complementary or a perfect match to the codon…

A: The codon is defined as a sequence of three nucleotide bases on messenger RNA responsible for…

Q: AKS 5c1: Which of the following models BEST represents heredity at the cellular level?* O MRNA (UAC…

A: Heredity is the summation of all biological phenomena through which specific characteristics are…

Q: 9) In another mutation from the original wild-type sequence, the bolded G in the middle of the…

A: The DNA is transformed into proteins through the process of transcription and translation. The…

Q: Define transcription and translation. Which process occurs first to make protein from DNA? 2. In…

A: Transcription is the process where RNA is synthesized from DNA. Translation is the process where…

Q: TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC…

A: Transcription is the process of production of an RNA segment from the strand of a gene sequence. The…

Q: Transcript the template DNA (write in mRNA codons) *

A: The synthesis of messenger RNA with the help of DNA is called transcription. The main enzyme of…

Q: 1. What mRNA sequence is synthesized from a section of DNA that is 3’-TTGACCT-5’?

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: Which partial peptide sequence is most likely to be part of a B-turn? O DERKY O LASIK O C VPGE O…

A: Proteins are the polymers of amino acids that of an alpha carbon or chiral carbon having four…

Q: (hitic 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the…

A: Question - 6: Transcription: - The synthesis of mRNA from DNA is called Transcription. - It is a…

Q: The human genome has 3.3 billion bases, of which 3% codes for protein. If a codon were four letters…

A: In most organisms, genetic information is stored in the form of the nucleotide sequence of DNA. This…

Q: F. RNA TRANSCRIPTION AND GENE EXPRESSION 1. The template strand of a segment of double-helical DNA…

A: Francis Crick proposed the central dogma which states that the DNA is replicated to produce DNA…

Q: 6. In the following graph, the dashed line shows the level of mRNA for a certain protein, Prot6, at…

A: The dashed line in the graph shows the level of mRNA for protein, Prot6 at various positions along…

Q: Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’…

A: According to Bartleby guidelines, we are required to attempt first three sub-parts in case of…

Q: 25. A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a…

A: The translation is a process of Protein synthesis where a copy of mRNA is used as a template strand.…

Q: 5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle…

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: Translate this RNA sequence into an amino acid sequence: 5'-AUG GGC UAC CGA-3'?

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: What anticodon would a suppressor tRNA have to have to suppress a 5'UAA3' stop codon?

A: A mutation in the gene that changes its anticodon loop for a tRNA molecule can "suppress" nonsense…

Q: This chapter describes different types of TEs, including insertionelements, simple transposons, LTR…

A: Transposable elements (TEs) are deoxyribonucleic acid (DNA) sequences that move from one location to…

Q: 8 QUESTION: Transcribe the gene. Write out the correct sequence of mRNA bases. Notice that this is…

A: Transcription is the synthesis of RNA from DNA segment with the help of RNA polymerase enzyme. It…

Q: Show an ionic bond between the histone and a DNA strand on the cartoon: histone protein NH3 NH3 H3N-…

A: Ans. Histones are a family of small, positively charged proteins that are critical in the packing of…

Q: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial…

A: # According to our guidelines we can answer only first 3 subparts or in case of short type questions…

Q: PPPP 2.7 essage hatentaded pruteiis? gene iS shown below (starting with ATG), What is the resulting…

A: We are authorized to answer one question at a time since you have not mentioned which question…

Q: a.) Draw a eukaryotic gene with four exons (include the location of the promoter, enhancer, start…

A: Exon is a coding region from DNA or mRNA transcript. They are interrupted by non-coding regions…

Q: How can methylation and acetylation of DNA and histones affect the production of a protein? Include…

A: DNA methylation, a process of adding a methyl group to DNA done by a DNA methyltransferase. The…

Q: 5. Compare and contrast transcription and translation. Transcription Translation What is the Start…

A: The central dogma of molecular biology explains the conversion of genetic information from DNA to…

Q: Write the mRNA sequence (5′ to 3′) that would result from transcription of the DNA sequence. (Note:…

A: Deoxyribonucleic acid or DNA is the type of nucleic acid present in the nucleus of the cell. It is…

Q: Human Chromosome 22 (48 × 106 nucleotide pairs in length) has about 700 protein-coding genes, which…

A: Introduction :- Chromosomes are thread-like structures within the nucleus that securely wrap DNA.…

Q: Why can introns be of any length?

A: Hey, since there are multiple questions posted, we will answer first question. If you want any…

Q: Fill in the blanks: The Lys60 (encoded by 5'-AAG-3' codon) of a protein is critical for its binding…

A: The ribonucleic acid or RNA is produced from these DNA by transcription process. Different types of…

Q: Which is the odd one out ? explain how the rest are related nucleoid cytoplasm RNA-binding protein…

A: Nucleoid can be defined as a region present in the prokaryotic cells,which contain genetic material.…

Question

Genetics question about COVID-19.

what are the mRNA codon sequences of the
2019-dominant and 2020-dominant Spike proteins?

(how did you determine the actual sequence?)

4. Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation:
(A)
(C)
Spike
Nucleocapsid
Membrane
S1 subunit
S2 subunit
Envelope
614
RNA viral genome
NTD
RBD
FP
HR1
HR2 TM CT
(B)
Binding site to ACE2
receptor in human cells
N terminal
domain
$1
Fusion
HR2
protein
S2
Transmembrane
domain and
cytoplasmic tail
Trends in Genetics
a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614
(that's why it's called the D614G mutant) in the S1 subunit of the Spike protein. Using only
the information above and a codon table, what are the mRNA codon sequences of the
2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed to
answer the question. Report in 5' to 3' orientation

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1. What impacts might mutations have on the transmission of the virus (COVID-19)? 2. At which stage of viral infection did these mutations most likely occur (COVID-19)?
1."What protein structural features are involved in the antigenic nature of epitopes? 2.What steps occur in the immune response following the primary infection of a vertebrate by a virus? 3.Assume you know that for a particular non‐enveloped virus, gene A codes for a transcriptional activator, gene B for an origin binding protein, and gene C for a capsid protein. Following a normal infection in an animal, what would most likely generate a neutralizing antibody?"
Describe and explain the difference in results if the serial dilution step of the T4 bacteriophage suspension inour experiment was skipped (i.e., all of Step #3 of the procedures was skipped)? _________________________Current EventsThe Johnson and Johnson COVID-19 vaccine consists of inactivated adenovirus that has been altered to containgenetic information encoding SARS-CoV-2 surface spike proteins. The virus targets and delivers this geneticinformation to the cells of our respiratory tract, which produce benign SARS-CoV-2 surface spike proteins butare effective for training our immune system to defend us against SARS-CoV-2.Based on this information and your knowledge of viruses in general, could T4 bacteriophage be used in place of
4. How do sialic acid conformations explain the difference between influenza strains that infect humans and those that infect chickens?
(65) A new strain of influenza virus emerges that results in world wide pandemic of influenza. Affected persons lack pre-existing immunity to this strain. Which of the following genetic mechanism best explains the emergence of this pandemic strain? (A) Deletion (B) insertion (C) Point Mutation (D) Reassortment (E) Recombination
6. How the use of the nucleic acid vaccine gives protection against diseases like COVID-19. Please explain it?
1)Describe the key processes involved in vaccine manufacturing.2) Review the literature and identify the key players in the various mutants of the spikeprotein.3) How were the structures of ACE 2 and spike protein solved?4) Why is it easier to target a single mutant versus multiple mutants in the virus?5) There are several coronaviruses in the database, why is the SARS-CoV-2 sodangerous?6) Summarize the key difference in the invasion of cells by:a. HIVb. Adenovirusc. Anthraxd. SARS-CoV-2e. MERS
3b. You were able to obtain the RNA of the influenza virus. If you injected this into a susceptible host cell could this RNA alone cause a lytic infection? Please explain why or why not with proper reasoning.
2. Bacteriophage are very specific in the types of cells they can infect. Some see this as a possible therapy to help treat against bacterial infections. Please discuss pros and cons of this type of therapy with proper support.
answer doesn't have to be long i just need an explanation, thank you! The whole world right now is concerned (or they should be) about the appearance of new variants of SARS-CoV-2. Among other things, these variant viruses have mutations that change the amino acid sequence of the spike protein on the virus surface. While this is concerning, I would like to propose that there is a limit to how far these mutations can change the spike protein. Why can't there be an endless number of new mutations of this viral protein? How would these amino acid changes affect how the virus works?
Many viruses that infect eukaryotic cells express genes that alterthe regulation of host gene expression to promote viral replication.For example, herpes simplex virus-1 (HSV-1) expresses aprotein called ICP0, which is necessary for successful viral infectionand replication within the host. Lutz et al. (2017. Viruses9: 210) showed that ICP0 can act as a ubiquitin ligase and targetthe redundant transcriptional repressors ZEB1 and ZEB2,which leads to upregulation of the miR-183 cluster (a set of threemiRNAs transcribed from the same locus). Speculate on how miR-183 cluster upregulation may benefitthe virus.
19. An investigaor is conducting a study of n outbreak of severe nausea, vomitting and diarrhea among28 guests in a hotel. It is found that the affected guests stayed in rooms located in the east wing of the thrid floorof the hotel during a single3-week period. The causal virus most likely has which of the following chracteristics? (A) DNA genome (B) Helical symmetry (C) No envelope (D) No polymerase gene (E) Segmented genome