Q: DIR TION: Express the following DNA nucleotide bases into amino acids A. 1. 3' ATA TTT CCG TAC CGC…
A: Gene expression is the process by which information from a gene is used in the synthesis of a…
Q: Maintenance methyltransferases recognize: CG sequences O CC sequences O CA sequences O CT sequences…
A: Question - Maintenance methyltransferases recognize: CG sequences CC sequences CA sequences CT…
Q: Cargaff rules tells us if we know the amount of one nucleobase for an orgnaiss DNA, we can deterine…
A: Chargaff's rule states that DNA in any organism consists of an equal amount of purines and…
Q: RNA polymerase transcribes the following DNA template strand: 5' ACC TTT CCG 3' What is the RNA…
A: Gene is the sequence of nucleotides that encode a particular protein.
Q: Expansion of a CAG repeat region by 1 repeat is an example of a frameshift mutation. Both DNA…
A: Frameshift mutation: It is a kind of genetic disorder that occurs due to insertion or deletion of…
Q: ou are given a segment of DNA : 5’ - CATGTCAAC – 3’ What is the complimentary strand?
A: Adenine in DNA always pairs with Thymine and cytosine always pairs with Guanine and vice versa .…
Q: he β subunit of polymerase has a function of ____________
A: RNA polymerase binds to the promoter region and initiates the transcription. The beta subunit is one…
Q: If you are a strong taster, how many bands would you expect on the gel after electrophroesis? O1 O 2…
A: Electrophoresis It is defined as the method through which DNA, RNA, or protein is separated on the…
Q: Which of the following in NOT a property of the Taq polymerase O A. 5-3'exonuclease activity O B.…
A: Taq Polymerase is a thermostable DNA polymerase 1, isolated from Thermus aquaticus. Thermus…
Q: ble opposite shows the standard (coding strand) DNA codes for the 20 amino acids involved in protein…
A: Introduction :- Gene expression is the process of formation of response or functional part through a…
Q: /hich of the following statemer ue about DNA polymerase: DNA polymerase can synthesiz- MRNA in the…
A: DNA polymerase (DNAP) is an enzyme that makes new copies of DNA in the form of nucleic acid…
Q: Choose the false statement: O Penicillin is a ß lactam which inhibits bacterial growth by inhibiting…
A: An antimicrobial is an agent that kills microorganisms or stops their growth. In this questions, we…
Q: table opposite shows the standard (coding strand et codes for the 20 amino acids involved in protein…
A: DNA is a nucleic acid.
Q: Polymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However,…
A: Nucleotides are the molecules composed of a sugar moiety, phosphate group, and a nitrogenous base.…
Q: TEIIB O contacts the DNA at the BRE will bind only if TFIID is bound O is the third factor to bind…
A: TFIIB is a transcription factor that helps to initiate the process of RNA polymerase II production.…
Q: UI ue bew strand requires the addition of a new dNTP to the 3 -OH g1 group of ovdes the immediate…
A: The synthesis of complementary DNA strand is called DNA replication.It is a very complex process…
Q: Silent Mutations in DNA – Notice one nucleotide pair differs from the normal sequence given in…
A: In silent mutations, a nucleotide change can contribute to no change in the phenotype, i.e., the…
Q: THCA 100 This reaction is Entropy is THC ( Leafly Mur AD RNA polymerase ATGACGOATCAGCCOCAAG…
A: Tetrahydrocannabinol Acid when heated converts into delta-9-tetrahydrocannabinol. the reaction is…
Q: 2. A biochemical analysis of an RNA sample showed 40 % ofnitrogenous bases were cytosine (C). What…
A: Nucleic acids are macromolecules. These are of two types - Deoxyribonucleic acid (DNA) and…
Q: DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl…
A: DNA polymerase is an enzyme involved in the synthesis of DNA molecules by joining the dNTPs…
Q: Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to…
A: Amino acids are the basic units (monomers) that makeup proteins. They consolidate to frame short…
Q: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in…
A: Mutation: - Random process - Non-directional - Most of the mutations are harmful - Most of the…
Q: Examine Figure 16.2b. Why do you think the motif of the DNA-binding protein shown is called a…
A: Deoxyribonucleic acid (DNA) binding proteins are proteins that attach to single stranded or double…
Q: bust me int Tly di gerlarat bu nd ambigu 22. Some tRNAS contain inosine, which can base pair with A.…
A: A transfer RNA or tRNA:It is a special type of RNA molecule. It helps in matching of an amino acid…
Q: The work ‘Hybridization’ in DNA finger printing meansa) Pairing between the nucleotides of DNA…
A: DNA fingerprint is by using the DNA sequence identifies individual a person is called DNA finger…
Q: he joining of a new nucleotide to a growing strand during DNA synthesis leads to the formation of a…
A: In molecular biology, DNA replication is an important procedure that occurs in the eukaryotic cell's…
Q: Whch of the folowng causes mutabons that are considered induced? O snigt Outomerction of purne and…
A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…
Q: DNA Polymerase of E.coli has 3 enzymatic activities. One is a 5'- 3 exonuclease. 1. what is its…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: 5. Match the description to the molecule(s). Each choice will be used only once. a. DNA b. mRNA C.…
A: All these terms are related to DNA, mRNA and tRNA. DNA stands for deoxyribonucleic acid. RNA stands…
Q: Bob's telomerase works extremely well (10x better than the average humans). Explain the function of…
A: Telomerase is an enzyme. It maintains length of telomere by adding repetative sequence that are…
Q: 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write…
A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…
Q: Apply all that you have learned to solve the folowng If you have the following DNA sequence…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Any RNA polymerase in any organism: OA Synthesizes RNA chains in the 3' to-5 direction O B. Binds…
A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…
Q: I need Question 39
A: Nucleotide excision repair is a type of mechanism of DNA repair which is particularly involved in…
Q: Escherichia coli's chromosome has a replication origin called OriC. Draw a schematic diagram to show…
A:
Q: Refer to Figure , which describes the base modifications of bacteriophage T4 DNA, and briefly…
A: As The main issue is relating to the modification of nucleotide - i.e. replacement of 5…
Q: RNA synthesis in eukaryotes and prokaryotes O occurs in the 3' to 5 direction. O none of the choices…
A: The synthesis of RNA is also known as Transcription. It is the process of converting or transcribing…
Q: True or false double strand rna is synthesized using taq polymerase. plasmids are linear…
A: In biotechnology different techniques has been developed for the synthesis and identification of…
Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…
A: The sense strand is the DNA strand that has the same sequence as mRNA, which uses the antisense…
Q: RNA polymerase differs from DNA polymerase in that: eukaryotes only have one kind of RNA polymerase…
A: RNA polymerase : It is an enzyme which helps in copying a DNA sequence into an RNA sequence , during…
Q: 8 of 15 GTTAA Plasmid Insert Ligase Glycosylase RATT G -O In this diagram, name the enzyme that…
A: Plasmid is extra chromosomal DNA. It has the ability to self replicate.
Q: A function of transfer RNA (ERNA) is to: O copy DNA and carry the information to the ribosome stay…
A: A transfer RNA is an adaptor molecule composed of RNA, typically 76 to 90 nucleotides in length,…
Q: The cleavage the triphosphate precursor into the monophosphate form drives the reaction, and…
A: In this reaction, the Nucleotide triphosphates (NTPs) are getting cleaved into Nucleotide…
Q: The coding (or “sense”)strand(again noticename ANDthe directionality)of DNAthat is known to encode…
A: The C-terminal residue in a peptide is one that has a free carboxyl group or does not acylate…
Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…
A: A sense strand, also known as a coding strand, is a stretch of double-stranded DNA that carries the…
Q: During DNA replication, the function of RNA primers is to O serve as a binding site for DNA ligase…
A: Introduction : Primer is a short sequence that is synthesised by primase (a type of RNA polymerase)…
Taq polymerase catalyze the formation :
of the phosphodiedter bond brtween 5phospjate group
of the 3OJ
of the hydrogen bond
non of them
Step by step
Solved in 2 steps
- Show the structure of a DNA where the lead strand is ATCG. Show H-, glycosidic, phosphoester bondings.4. Differentiate replication, transcription and translation by describing the changes which occur in each process.Cargaff rules tells us if we know the amount of one nucleobase for an orgnaiss DNA, we can deterine each of the oter. Can te same be said for a organisms RNA. Explain.Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.
- Energy that drives translation is provided mainly by ___ . a. ATP b. amino acids c. CTP d. all of the aboveVISUALIZE Sketch a pyrimidine nucleotide subunit that would be found only in RNA. Circle and label the three components that make up this type of nucleotide. Explain what changes in the functional groups of this subunit would have to occur for it to be found in a DNA molecule.The coding (or “sense”)strand(again noticename ANDthe directionality)of DNAthat is known to encode the C-terminal end of a long E. coliprotein has the following nucleotide sequence:5′–CCATGCAAAGTAATAGGT–3′Give the sequence of the last three amino acids of the protein (label the C-terminus).
- 5. The Cy3 and Cy5 molecules were used in a FRET experiment. (e) Describe how the appearance of the donor and acceptor fluorescence spectrum will be different for the 12 base pair (bp) construct and the 21 base pair (bp) construct. Draw a spectrum for each.Check the new protein created by your new DNA. Describe how this changed the protein (amino acid sequence).BTW- I added a T after the first triplet so it should read ATGTCC. Thanksa. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
- Polymerases work is to add 10 nucleotides to a DNA strand before dissociating. During replication process, DNA pol III can add tens of thousands of nucleotides at a moving fork. How this additionaccomplished?Give me nucleotide sequence with pairing. Like this ATC TCA TGA GCC TAG AGT ACT. CGGWhy does a dual layer of Cr/Au (20/100nm) delaminate during a GSTAT electrochemical polymerization of Pedots;pss
