Q: How many different mRNA sequences can encode a polypeptide chain with the amino acid sequence…
A: Polypeptide chain includes a sequence of amino acids that are coded by different codons during the…
Q: Using the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA…
A: Transcription is a process of formation of transcript or RNA from DNA by the process of…
Q: TRACE THE CODE| Order of bases in MRNA (codon) AUC Order of bases in ERNA (anticodon) Order of bases…
A: Complete this table of codes.
Q: From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change one base in codon 8 to…
A: The genetic material of the cell, that is, the DNA (deoxyribonucleic acid) comprises various coding…
Q: The first three codons for a mRNA sequence are 5’ GGC AAG UCU 3', What anticodons will the correct…
A: * mRNA that is also called as messenger ribonucleic acid is a single stranded RNA corresponds to…
Q: Write all the possible mRNA sequences that can code for a simple tripeptide segment Leu-Trp-Glu.…
A: Translation is the process of conversion of mRNA to protein . In this , Each codon is basically a…
Q: A DNA codon of ATT is complementary to UAA this RNA codon. This codon terminates a coding region.…
A: Codon can be defined as the trinucleotide sequence of DNA or RNA which corresponds to a specific…
Q: Which of the following anticodons can recognize BOTH codons for Aspartate (Asp)? Question 36…
A: The deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…
Q: If the codon in the mRNA is 5' AUG', then the anticodon of the initiator tRNA is 5' CAT3' O 3' UAC5'…
A: CODON- It is a unit of three nucleotides that forms a genetic code in a DNA/RNA.
Q: Directions: Transcribe the DNA sequence in the space provided. Use your notes and what you know.…
A: Transcription A process of making of mRNA from DNA. mRNA contain information about polypeptide…
Q: The circled portion labeled Y is known as a(n): O ribosome O DNA molecule codon TRNA molecule O…
A: The translation occurs in the cell's cytoplasm. Firstly, a nascent mRNA or pre-mRNA synthesized by…
Q: Send A PEETRAS O
A: Transcription is the process of formation of RNA from the DNA.The transcription process takes place…
Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…
A: Mutations are sudden heritable changes in the nucleotide sequence of a gene that changes the amino…
Q: Which of the following codons is not a termination codon for protein synthesis?a) UUUb) UAGc) UAAd)…
A: UUU is not a termination codon for protein synthesis. Hence option a is the right answer UUU codes…
Q: Complete the table below showing the sequences of DNA, MRNA codons, RNA anticodons and the amino…
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A…
Q: 3. Using your Genetic Code, translate and group the following MRNA bases. Example: UAC CAG UGG UUU…
A: a. 5 'CUC GGU ACG UAA UAG AUC UAU CAU CCG AGA CUC UUA AAU 3' ANSWER: 5' Leu Gly Thr Stop Stop Ile…
Q: A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1.…
A: Translation or protein synthesis is the third major step of the central dogma of life. mRNA…
Q: Which amino acid is carried by the tRNA with the anticodon 5'-UCA-3'? None-this is a stop codon. OI.…
A: The process of translation helps in formation of long chains of amino acids ie, polynucleotides. We…
Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA
A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…
Q: The anticodon loop of one of the t RNA Gly molecules from Escherichia coli is as follows: C--G G--C…
A: tRNA is a specialised RNA molecule that transports the amino acids during translation. A tRNA is…
Q: The tRNA for Phe binds to the mRNA codon UUU. You mutate the anticodon of the Phe-tRNA from AAA to…
A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…
Q: An anti-codon is on what kind of molecule? O DNA O TRNA O polypeptide O MRNA
A: An anticodon is a tri-nucleotide sequence which is complementary to the codon sequence present on…
Q: What is the sequence of the peptide that would result following translation with a ribosome?…
A: Translation is the process in which the mRNA is converted into a long chain of polypeptide called…
Q: Use the codon wheel on page 10.11 to identify any stop codons in the stop codons. Use the codon…
A: During transcription process RNA is formed with the help of complementary base pairing with template…
Q: CGG CCA UGU AUA UAA Enter your answer as a string without dashes, using three-letter abbreviations…
A: DNA ( Deoxyribonucleic acid) is a ladder like helical structure which serves as genetic material in…
Q: Each combinations of nitrogen bases on the mRNA molecule is a codon, which is a three letter code…
A: 4) tryptophan- UGG 5) Leucine- CUU, CUC, CUA, CUG
Q: Write the amino acid sequence based on the following portion of MRNA. Write the name of the amino…
A: The codons which are present on mRNA are will code for specific amino acids based on genetic code…
Q: Figure 3 represents one process that occurs during protein synthesis. amino acid - molecule Q A UGC…
A: Note - Since you have posted a question with multiple sub-parts, we will solve the first three…
Q: Follow the path of codons to discover the peptide and unlock the Directional Multilock. (Hint: type…
A: Peptide formed from given mRNA sequences.
Q: 2. Transcribe the following gene sequence to the appropriate MRNA codons: TCA TTT cCA CAG ACA * AGU…
A: Transcription is defined as the process of RNA formation from the template strand of DNA by the…
Q: hange the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the…
A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…
Q: For a TTT triplet of bases in the template sequence of DNA, the anticodon on the TRNA that binds the…
A: The anticodon is a trinucleotide sequence found on tRNA that controls which amino acid it…
Q: Most codons specify a(n)____ . a. protein c. amino acid b. polypeptide d. mRNA
A: A codon may be defined as a tri-nucleotide sequence of DNA or RNA that for a specific amino acid.…
Q: AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons…
A: Introduction When DNA makes the same copy of itself then it is called replication. Each replicated…
Q: AAA CC GG G CA GG CCGU Phe Gly Arg
A: * Transcription is the process of copying DNA segment into RNA. *The DNA segments transcribed into…
Q: The following sequence represents triplets on DNA:TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA…
A: Hello, thank you for your question. The second part of the question seems to be incomplete,…
Q: If the codon for Histidine is 5' CAU 3' in an MRNA molecule, the anticodon on the TRNA is: UAC ATG…
A: In every group of messenger ribonucleic acid (mRNA), there are three bases. A codon is also there…
Q: . ) In one (1) sentence point out a key structural similarity and difference in each of the…
A: Biomolecules are abundant biological molecules present in the body like carbohydrates, proteins,…
Q: Which statement about transfer RNA (TRNA) is NOT correct? Select one: O It folds up into the shape…
A: Transcription in the process which is responsible for synthesis of RNA from the template strand of…
Q: Here is a DNA sequence that codes for an extremely short protein. 3' TTACGTGCCGATCGAA 5' template…
A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…
Q: The first MRNA codon to specify an amino acid is always Phe Leu (F) (L) Glu Asp (E) (D) Ser (S) Tyr…
A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…
Q: ction of a Gene AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following:…
A: AAG ATA CAG GCT CGG TAA : DNA
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: Translation is the process of formation of protein from mRNA As in the question above start codon is…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The diagram illustrates the process of elongation of polypeptide chain by adding amino acids one by…
Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…
A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…
Q: Indicate the mRNA sequence, coding sense DNA sequence and template DNA sequence that produced the…
A: Though it is easier to decide the sequence of amino acids from a given segment of either DNA (any…
Q: Following the 5-> 3' conversion of writing nucleotide sequence, indicate which of the following MRNA…
A:
Q: 8. Codons are sequences that correspond to specific amino acids or signals during protein…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: The mRNA codon of valine is GUC UGG CCA TTG
A: Each codon in mRNA is made up of three nucleotides, and each codon indicates a certain amino acid…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A molecule of composition5′-AAAAAAAAAAA-3′3′-TTTTTTTTTTTTT-5′is replicated in a solution containing unlabeled (notradioactive) GTP, CTP, and TTP plus adenine nucleoside triphosphate with all its phosphorus atoms in theform of the radioactive isotope 32P. Will both daughtermolecules be radioactive? Explain. Then repeat thequestion for the molecule5′-ATATATATATATAT-3′3′-TATATATATATATA-5′Pectin, which occurs in plant cell walls, exists in nature as a polymer of D-galacturonic acid methylated at carbon 6 of the monomer. Draw a Haworth projection for a repeating disaccharide unit of pectin with one methylated and one unmethylated monomer unit in α(1 -->4) linkage. Thank you.Pectin, which occurs in plant cell walls, exist in nature as a polymer of D-galacturonic acid methylated at carbon 6 of the monomer. Draw a haworth projection for a repeating disaccharide unit of pectin with one methylated and one unmethylated monomer unit in a (1-->4) linkage
- The enzyme thiouridylase converts certain tRNA uridine residues to 2-thiouridine. Draw the structure of this modified nucleotide.Pectin, which occurs in plant cell walls, existsin nature as a polymer of d-galacturonic acid methylated at carbon 6 of the monomer. Draw a Haworth projection for a repeatingdisaccharide unit of pectin with one methylated and one unmethylated monomer unit in a(1 -> 4) linkageGiven a primer sequence 3’- CTGGGAAACATTCTGGAT - 5’, compute for the melting temperature of this 18-mer.
- His-Met-Asp-Tyr-Phe-Ser Calculate an approximate pI (isoelectric point) for this peptide. Please use the pKa's listed within Table 3-1 of Lehninger. Show and/or explain all your work; you must be very clear about WHY you use particular pKa's in your calculation.structure of phenylalanyl tyrosyl seryl histidine5'-AAGUCCUAGU-3' In the structure above, there are 10 deoxyribose sugars. This statement is: True or False?
- Remembering that the amino acid side chains projecting from each polypeptide backbone in a β sheet point alternately above and below the plane of the sheet, consider the following protein sequence: Leu-Lys-Val-Asp-Ile-Ser-Leu-Arg- Leu-Lys-Ile-Arg-Phe-Glu. Do you find anything remarkable about the arrangement of the amino acids in this sequence when incorporated into a β sheet? Can you make any predictions as to how the β sheet might be arranged in a protein?The hormones oxytocin and vasopressin are 9-mer peptides than differ in the identity of only two residues, yet have very different functions. In contrast, the primary structure of insulin varies the identity of four amino acids in different species but maintains the same function. Offer an explanation that resolves this contradiction in the role of primary sequence.Draw the α-l-glucopyranose sugars using Haworth projections: