Vector- Disrupted lacZ' gene lacZ' gene `Insert MRNA MRNA Non-functional Functional lacz' gene product protein | Blue colonies White colonies Bacterial cells plated on medium containing X-gal FIGURE 9.9 The Function of the lacZ' Gene in a Vector The lacZ' gene is used to differentiate cells that contain recombinant plasmid from those that contain vector alone.

Vector- Disrupted lacZ' gene lacZ' gene `Insert MRNA MRNA Non-functional Functional lacz' gene product protein | Blue colonies White colonies Bacterial cells plated on medium containing X-gal FIGURE 9.9 The Function of the lacZ' Gene in a Vector The lacZ' gene is used to differentiate cells that contain recombinant plasmid from those that contain vector alone.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 9P: Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram...

See similar textbooks

Similar questions

I-Assume that a circular plasmid is 3200 base pairs in length and has restriction sites for HindIII restriction enzyme at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion.
Assume a 5250 base pair, closed circular plasmid with 10 negativesupercoils.(a) Calculate the values of twist (T), writhe (W), and linking number (L) for thisplasmid (use 10.5 base pairs/turn for B-DNA)(b) Your starting plasmid is now A-DNA instead of B-DNA. What is the linkingnumber required to have 10 negative supercoils in this plasmid? (R = 8.3145 J−1 K mol−1; 0 ◦C = 273.15 K; Faraday Constant , F =96485 J V−1 mol−1.)
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram the recombinational event leading to the formation of a heteroduplex DNA region within a bacteriophage chromosome.
Homologous Recombination, Heteroduplex DNA, and Mismatch Repair Homologous recombination in E. coli leads to the formation of regions of heteroduplex DNA. By definition, such regions contain mismatched bases. Why doesnâ€™t the mismatch repair system of E. coli eliminate these mismatches?
Multiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram illustrating replication of the circular E. coli chromosome (a) at an early stage, (b) when one-third completed, (c) when two-thirds completed, and (d) when almost finished, assuming the initiation of replication at oriC has occurred only once. Then, draw a diagram showing the E. coli chromosome in problem 3 where the E. coli cell is dividing every 20 minutes.
You are cloning the genome of a new DNA virus into pUC18.You plate out your transformants on ampicillin plates containing X-gal and pick one blue colony and one white colony.When you check the size of the inserts in each plasmid (blueand white), you are surprised to fi nd that the plasmid fromthe blue colony contains a very small insert of approximately60 bp, while the plasmid from the white colony does notappear to contain any insert at all. Explain these results.
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Nonhomologous end-joining (NHEJ) of a doublestrand break almost always results in perfect resealingof the DNA lesion, without the loss or gain of nucleotide pairs. Yet CRISPR/Cas9, which produces doublestrand breaks, is a highly efficient method of makingsmall deletions or insertions at the targeted site. Howcan you resolve this apparent contradiction?
2AQ:You are cloning the genome of a new DNA virus into pUC18.You plate out your transformants on ampicillin plates containing X-gal and pick one bluecolony and one white colony. When you check the size of the inserts in each plasmid (blueand white), you are surprised to find that the plasmid from the blue colony contains a verysmall insert of approximately 60 bp, while the plasmid from the white colony does notappear to contain any insert at all. Explain these results.
#3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?