Genetic Analysis: An Integrated Approach Plus Mastering Genetics with Pearson eText -- Access Card Package (3rd Edition) (What's New in Genetics)
3rd Edition
ISBN: 9780134807799
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 1, Problem 19P
A portion of a polypeptide contains the amino acids Trp-Lys-Met-Ala-Val. Write the possible mRNA and template strand DNA sequences. (Hint: Use A/G and T/C to indicate that either adenine/guanine or thymine/cytosine could occur in particular position, and use N to indicate that any DNA
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A small section of a gene for a protein has the following nucleotide sequence:
GCT CTA GCT ATC TGA
Which of the following mutations would cuase a silent mutation in the sequence shown above?
a. Replacement of second adenine base with thymine base
b. Replacement of first thymine base with adenine base
c. Replacement of second guanine base with cytosine base
d. Replacement of first cytosine base with guanine base
A small section of a gene for a protein has the following nucleotide sequence:
CCT AAG GAT TCA CTT
Which of the following mutations would cause a missense mutation in the sequence shown above?
a. Replacement of first guanine base with cytosine base
b. Replacement of first thymine base with cytosine base
c. Replacement of second thymine base with adenine base
d. Replacement of seond guanine base with adenine base
A small section of a gene for a protein has the following nucleotide sequence:
TAT AGG GAC CTA TGT
Which of the following mutations would cause a missense mutation in the sequence shown above?
a. Replacement of first cytosine base with guanine base
b. Replacement of final thymine base with guanine base
c. Replacement of second guanine base with cytosine base
d. Replacement of first thymine base with adenine base
Chapter 1 Solutions
Genetic Analysis: An Integrated Approach Plus Mastering Genetics with Pearson eText -- Access Card Package (3rd Edition) (What's New in Genetics)
Ch. 1 - 1. Genetics affects many aspects of our lives....Ch. 1 - 2. How do you think the determination that DNA is...Ch. 1 - 3. A commentator once described genetics as “the...Ch. 1 - All life shares DNA as the hereditary material....Ch. 1 - Define the terms allele, chromosome, and gene and...Ch. 1 - 6. Define the terms genotype and phenotype, and...Ch. 1 - 7. Define natural selection, and describe how...Ch. 1 - Describe the modern synthesis of evolution, and...Ch. 1 - What are the four processes of evolution? Briefly...Ch. 1 - Define each of the following terms: a....
Ch. 1 - 11. Compare and contrast the genome, the proteome,...Ch. 1 - With respect to transcription describe the...Ch. 1 - Plant agriculture and animal domestication...Ch. 1 - Briefly describe the contribution each of the...Ch. 1 - If thymine makes up 21% of the DNA nucleotides in...Ch. 1 - What reactive chemical groups are found at the 5...Ch. 1 - Identify two differences in chemical composition...Ch. 1 - What is the central dogma of molecular biology?...Ch. 1 - A portion of a polypeptide contains the amino...Ch. 1 - The following segment of DNA is the template...Ch. 1 - 23. Fill in the missing nucleotides (so there are...Ch. 1 - 24. Suppose a genotype for a protein-producing...Ch. 1 - Prob. 25PCh. 1 - 26. Four nucleic acid samples are analyzed to...Ch. 1 - 27. What is meant by the term homology? How is...Ch. 1 - 28. If one is constructing a phylogeny of reptiles...Ch. 1 - 29. Consider the following segment of...Ch. 1 - 30. Ethical and social issues have become a large...Ch. 1 - 31. In certain cases, genetic testing can identify...Ch. 1 - 32. What information presented in this chapter and...Ch. 1 - 33. It is common to study the biology and genetics...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?arrow_forwardHow many kilobases of the DNA strand below will code for the protein product?arrow_forwardIf the genetic code used 4 bases at a time, how many amino acids could be encoded?arrow_forward
- A small section of a gene for a protein has the following nucleotide sequence:CTG GGA TCC TAA GGTWhich of the following mutations would cause a nonsense mutation in the sequence shown above? Select one: a. Replacement of second adenine base with a cytosine base b. Insertion of guanine base after the first thymine base c. Insertion of guanine base after the first adenine base d. Replacement of second cytosine base with a adenine basearrow_forwardA small section of a gene for a protein has the following nucleotide sequence: CTA TCC CCT ACG TCA Which of the following mutations would cause a silent mutation in the sequence shown above? a. Replacement of first thymine base with adenine base b. Replacement of second thymine base with guanine base c. Replacement of first cytosine base with guanine base d. Replacement of second adenine base with thymine basearrow_forwardThe template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary DNA strand?arrow_forward
- Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?arrow_forwardTranslate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’arrow_forwardWhich of the following describe how the order of nucleotide bases along a gene in the DNA ultimately determines the primary structure of a protein and how the primary structure ultimately determines the three-dimensional shape and function of the protein coded for by that gene. A Certain amino acids in a protein interact with other amino acids in that same protein and so the order of amino acids ultimately determines the 3-dimensional tertiary structure of that protein. B The order of nucleotide bases along the DNA is transcribed into complementary tRNA which is translated into the correct amino acid sequence for the protein by mRNA. C The order of nucleotide bases along a gene determines the order of amino acids in the resulting protein. The order of amino acids in the protein is called its secondary structure.arrow_forward
- The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand?arrow_forwardThe template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?arrow_forwardFor a DNA template strand containing the sequence 3'AATTGGCC 5', what is the sequence of nucleotides from the 5' to the 3' end in the mRNA transcript?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY