Genetics: From Genes To Genomes (6th International Edition)
6th Edition
ISBN: 9781260041217
Author: Leland Hartwell Dr., ? Michael L. Goldberg Professor Dr., ? Janice Fischer, ? Leroy Hood Dr.
Publisher: Mcgraw-Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 10, Problem 12P
Give two different reasons for the much higher ratio of total DNA to protein-encoding DNA in the human genome as compared to bacterial genomes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
See the attachment and answer the following parts of the question:
A) If the binturong genome is 2.87 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'ATGGTCC3' and its complement, how many copies of this sequence are present in the binturong genome?
B) Briefly explain, in your own words, why the fraction of the binturong DNA fragments that reannealed relatively slowly took so much longer to renature than the other DNA fragments.
C) If you took more of the same randomly generated 1000 bp fragments of binturong DNA (the same sample that you used in the equilibrium density gradient centrifugation experiment described in part a and the C0t curve described in part b of this question) and used them as a sample in agarose gel electrophoresis, how many bands would you expect to find in the gel when you turned off the current and stained the gel with ethidium bromide? Briefly explain why you would predict that number of bands.
Although DNA transposons are abundant in the genomes of multicellular eukaryotes, class 1 elements usually make up the largest fraction of very large genomes such as those from humans (~2500 Mb), maize (~2500 Mb), and barley (~5000 Mb). Given what you know about class 1 and class 2 elements, what is it about their distinct mechanisms of transposition that would account for this consistent difference in abundance?
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence:
3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'.
What is the sequence of the partner strand?
4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
4C. In NOT more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus?
Chapter 10 Solutions
Genetics: From Genes To Genomes (6th International Edition)
Ch. 10 - Prob. 1PCh. 10 - List three independent techniques you could use to...Ch. 10 - Figure 10.2a has numbers indicating the...Ch. 10 - Which of the enzymes from the following list would...Ch. 10 - Prob. 5PCh. 10 - a. What sequence information about a gene is...Ch. 10 - Why do geneticists studying eukaryotic organisms...Ch. 10 - Consider three different kinds of human libraries:...Ch. 10 - The human genome has been sequenced, but we still...Ch. 10 - This problem investigates issues encountered in...
Ch. 10 - For the sake of simplicity, Fig. 10.4 omitted one...Ch. 10 - Give two different reasons for the much higher...Ch. 10 - Using a cDNA library, you isolated two different...Ch. 10 - The figure that follows shows part of a modified...Ch. 10 - In Problem 14, cDNAs F and G could not be found in...Ch. 10 - Fig. 10.10 presents a model for exon shuffling in...Ch. 10 - An interesting phenomenon found in vertebrate DNA...Ch. 10 - a. If you found a zinc-finger domain which...Ch. 10 - Prob. 19PCh. 10 - In the human immune system, so-called B cells can...Ch. 10 - Chimpanzees have a set of hemoglobin genes very...Ch. 10 - Complete genome sequences indicate that the human...Ch. 10 - On your computers browser, view the page accessed...Ch. 10 - Prob. 24PCh. 10 - Prob. 25PCh. 10 - Certain individuals with mild forms of...Ch. 10 - The 1 and 2 genes in humans are identical in their...Ch. 10 - Prob. 28P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.arrow_forwardWith a few exceptions, interspersed repetitive DNA in the human genome has no known biological function. Explain in a few sentences what interspersed means. Name and describe one interspersed repetitive element. Provide information on about how much of the human genome consists of this one repetitive element (copy number and/or percent of genome).arrow_forwardThe DNA sequence of the genome of a virus is known and contains equal number of A, TG and C. The genome is composed of double stranded DNA molecule. It is 10Kb in length. If one searches the genome for the presence of the following sequence 5'-AAAAAA-3'/3'-TTTTTT-5', predict the number of such stretches that are likely to occur. (1Kb = 1000 base pairs). a) Two b) Eight c) Sixteen d) Thirty twoarrow_forward
- The human genome (3.4 Gb) would be 2.3 metres long if stretched linearly. In not more than 200 words, explain how a genome of this size is fit into a cell of minuscule proportions.arrow_forwardE. How many nucleotides would be required to generate a polypeptide that is 15 amino acids long? This requires knowing how many nucleotides of DNA code for one amino acid. F. Assuming that there are between 20,000-25,000 genes in the human genome, do you think there are 1) fewer, 2) approximately the same number, or 3) more proteins in the human genome? Explain your answer.arrow_forwardGiven the fact that 1 fg of DNA = 9.78 * 105base pairs (on average), you can convert the amount of DNA per cell to the lengthof DNA in numbers of base pairs. (a) Calculate the number of basepairs of DNA in the haploid yeast genome. Express your answer inmillions of base pairs (Mb), a standard unit for expressing genomesize. Show your work. (b) How many base pairs per minute weresynthesized during the S phase of these yeast cells?arrow_forward
- The human genome (3.4Gb) would be 2.3 metres long if stretched linearly. In not more than 200 words, explain how a genome of this size is fit into a cell if minuscule proportionsarrow_forwardThe principal genomic component isolated from equine influenza virus is 22% C, 23% A, 22% G and 33% U. Is this sufficient data to determine whether the genomic material is DNA/RNA and is double- or single-stranded? Why or why not? Explain, using a diagramarrow_forwardSupercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more compact structure with enhanced physical stability. Describe the enzymes that control the number of supercoils present in the E. coli chromosome. How much would you have to reduce the linking number to increase the number of supercoils by five?arrow_forward
- Consider a genome whose length is 1000 bp. "Shotgun" sequencing techniques are applied to the genome, resulting in 20 reads, with an average length of 50 bp. A very important point is that, even though 20×50 = 1000, there is no guarantee that ALL 1000 bp of the genome are represented in the fragments. Calculate the coverage. What does this value mean? Why would it be a good idea to have a coverage greater than 1?arrow_forwardthe one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?arrow_forwardWould you be more likely to find single nucleotidepolymorphisms (SNPs) in the protein-coding or in thenoncoding DNA of the human genome?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license