a.
To determine:
The consensus sequence that is common to the four regions given in the problem.
Introduction:
The consensus sequence is a sequence of amino acids in protein or bases in DNA or RNA. It is generally found within all known protein domains or regions of DNA or RNA with the same particular function.
b.
To determine:
The reason for defining the consensus sequence and the method by which it would be decided whether the four sequences were worth comparing to define a consensus.
Introduction:
The consensus sequences are a small stretch of amino acids that share a common sequence among a common family of genes.
c.
To determine:
The mechanism to use the general strategy for defining a consensus sequence to determine which amino acids of a protein are most crucial for its function.
Introduction:
The consensus sequence is important to define because it helps in determining the small changes and the similarity in functions among diverse organisms. It helps in understanding the residues which remain the same and which changes.
Want to see the full answer?
Check out a sample textbook solutionChapter 10 Solutions
Genetics: From Genes To Genomes (6th International Edition)
- Imagine that you repeat the tRNA Selection experiment with modifications as follows: 1. Synthesize mRNA containing A's and G's only (poly-AG in random order). 2. Convert the amino acid Glutamic acid (Glu) on its tRNA to the amino acid Glutamine (Gln) as shown below. 3. Mix your poly-AG RNA, your artificial tRNA, and cell extract (contains ribosomes, amino acids, all normal tRNAs, and the energy source for translation). Phe Tyr GAA GAA Glutamic acid (Glu) is encoded by GAA and GAG, while Glutamine (Gln) is encoded only by CAA and CAG. What does the outcome of this experiment tell us about translation? Multiple codons code for each amino acid. An amino acid is selected based on the identity of the tRNA. The ribosome does the translation, i.e. it selects the amino acid regardless of the identify of the tRNA. The ribosome reads mRNA 3 bases at a time.arrow_forwardShown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?arrow_forwardAbout 60% of the base pairs in the human genome are AT. If the human genome has 3.2 billion base pairs of DNA, about how many times will the following restriction sites be present? a. BamHI (recognition sequence is 5′–GGATCC–3′) b. EcoRI (recognition sequence is 5′–GAATTC–3′) c. HaeIII (recognition sequence is 5′–GGCC–3′)arrow_forward
- You obtain the DNA sequence of a mutant of a 2-kb gene in which you are interested and it shows base differences at three positions, all in different codons. One is a silent change, but the other two are missense changes (they encode new amino acids). How would you demonstrate that these changes are real mutations and not sequencing errors? (Assume that sequencing is about 99.9 percent accurate.)arrow_forwardWith regards to this sequence below please answer this quistions 1) What is the format of the sequence below and why 2) What do you understand by a query sequence 3) What is the sequence size of this sequence 4) What is the ID of the sequence and indicate the taxonomic rank of the ID ATGAAAAAACGAAAAGTGTTAATACCATTAATGGCATTGTCTACGATATTAGTTTCAAGCACAGGTAATT TAGAGGTGATTCAGGCAGAAGTTAAACAGGAGAACCGGTTATTAAATGAATCAGAATCAAGTTCCCAGGG GTTACTAGGATACTATTTTAGTGATTTGAATTTTCAAGCACCCATGGTGGTTACCTCTTCTACTACAGGG GATTTATCTATTCCTAGTTCTGATAGAAAATATTCCATCGGAAAACCAATATTTTCAATCTGCTATTTGG TCAGGATTTATCAAAGTTAAGAAGAGTGATGAATATACATTTGCTACTTCCGCTGATAATCATGTAACAA TGTGGGTAGATGACCAACAAGTGATTAATAAAGCTTCTAATTCTAACAAAATCAGATTAGAAAAAGGA AGATTATATCAAATAAAAATTCAATATCAACGAGAAAATCCTACTGAAAAAGGATTGGATTTCAAGTTGT ACTGGACCGATTCTCAAAATAAAAAAGAAGTGATTTCTAGTGATAACTTACAATTGCCAGAATTAAAACA AAAATCTTCGAACTCAAGAAAAAAGCGAAGTACAAGTGTGGACCTACGGTTCCAGACCGTGACAATGAT GGAATCCCTGATTCATTAGAGGTAGAAGGATATACGGTTGATGTCAAAAATAAAAGAACTTTTCTTTCAC…arrow_forwardA hexapeptide of unknown sequence was isolated from an amphibian skin then sequenced. The following were the results of the sequencing process: A. When the peptide was treated with dinitrofluorobenzene (DNFB), DNP-ala and a mixture of amino acids were produced. B. When the same intact peptide was treated with trypsin, a tetrapeptide of composition arg, met, ala and ser and a dipeptide were released. C. Treatment with elastase gave 2 amino acids and a tetrapeptide of the same composition were also released. D. When the hexapeptide was also treated with cyanogen bromide, a dipeptide and a tetrapeptide also of the same composition were also released. Questions: 1. What is the sequence of the hexapeptide if it is composed of ser, met, ala and arg only? 2. What is the pl of the hexapeptide? 3. What is its charge at physiological pH (6.7-7.4) and where would you find this in a lane of an electropherogram?arrow_forward
- Describe the outcome of a chain-terminator sequencing procedure in which (a) too little ddNTP is added or (b) too much ddNTP is added.arrow_forwardAs part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. (a) Give TWO possible causes of your protein becoming truncated. explainarrow_forwardAs part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. 1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explainarrow_forward
- Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forwardCalculate the expected number of times that a given 8-base-pair DNA site should be present in the E. coli genome. Assume that all four bases are equally probable. Repeat for a 10-base-pair site and a 12-basepair sitearrow_forwardThe following DNA sequences found on the sense strand belong to the same eukaryotic gene: Sequence 1: 5'-GATTCAATAAAGCTCAGATCGCTCACGTCGCGACTC-3' Sequence 2: 5'-TCCGAGGTCACTAGATACTCGTCGATCGTATAAATG-3' a) Which sequence is likely to be found upstream from the coding sequence? Justify your answer. b) Which sequence is likely to be found downstream from the coding sequence? Justify your answer. c) Which sequence will not be transcribed into an mRNA transcript? Justify your answer.arrow_forward
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning