Genetics: From Genes To Genomes (6th International Edition)
6th Edition
ISBN: 9781260041217
Author: Leland Hartwell Dr., ? Michael L. Goldberg Professor Dr., ? Janice Fischer, ? Leroy Hood Dr.
Publisher: Mcgraw-Hill
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 10, Problem 17P
An interesting phenomenon found in vertebrate DNA is the existence of pseudogenes, nonfunctional copies of a gene found elsewhere in the genome. Some pseudogenes appear to have originated as double-stranded DNA copies of mature mRNA inserted into the chromosome; these copies later underwent mutations to make them into pseudogenes.
a. | What sequence information might provide clues that the original source of some of these pseudogenes is cDNA copied in cells from mRNA and then inserted into the genome? |
b. | Would this mechanism of generating pseudogenes be more likely to have operated if the pseudogene was part of a gene family clustered in one region of the genome, or if it was instead part of a gene family whose members are scattered around the genome? Explain. |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain gene
After Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun” technique, every DNA sequence of Drosophila in a library can be recovered.a. How would you identify a clone that contains DNA encoding the protein actin, whose amino acid sequence is known?b. How would you identify a clone encoding a specific tRNA?
Sometimes, cDNAs turn out to be “chimeras”; that is, fusions of DNA copies of two different mRNAs accidentally inserted adjacently to each other in the same clone.You suspect that a cDNA clone from the nematodeCaenorhabditis elegans is such a chimera because the sequence of the cDNA insert predicts a protein with twostructural domains not normally observed in the sameprotein. How would you use the availability of the entiregenomic sequence to assess if this cDNA clone is a monster or not?
Chapter 10 Solutions
Genetics: From Genes To Genomes (6th International Edition)
Ch. 10 - Prob. 1PCh. 10 - List three independent techniques you could use to...Ch. 10 - Figure 10.2a has numbers indicating the...Ch. 10 - Which of the enzymes from the following list would...Ch. 10 - Prob. 5PCh. 10 - a. What sequence information about a gene is...Ch. 10 - Why do geneticists studying eukaryotic organisms...Ch. 10 - Consider three different kinds of human libraries:...Ch. 10 - The human genome has been sequenced, but we still...Ch. 10 - This problem investigates issues encountered in...
Ch. 10 - For the sake of simplicity, Fig. 10.4 omitted one...Ch. 10 - Give two different reasons for the much higher...Ch. 10 - Using a cDNA library, you isolated two different...Ch. 10 - The figure that follows shows part of a modified...Ch. 10 - In Problem 14, cDNAs F and G could not be found in...Ch. 10 - Fig. 10.10 presents a model for exon shuffling in...Ch. 10 - An interesting phenomenon found in vertebrate DNA...Ch. 10 - a. If you found a zinc-finger domain which...Ch. 10 - Prob. 19PCh. 10 - In the human immune system, so-called B cells can...Ch. 10 - Chimpanzees have a set of hemoglobin genes very...Ch. 10 - Complete genome sequences indicate that the human...Ch. 10 - On your computers browser, view the page accessed...Ch. 10 - Prob. 24PCh. 10 - Prob. 25PCh. 10 - Certain individuals with mild forms of...Ch. 10 - The 1 and 2 genes in humans are identical in their...Ch. 10 - Prob. 28P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- a molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. he knows that the nucleotide sequence of a small part of the gene is gtggactgaca. briefly explain how to obtain the desired gene answerarrow_forwardA molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. He knows that the nucleotife sequence of a small part of the gene is GTGGACTGACA. Briefly explain how to obtain the desired gene.arrow_forwardA molecular geneticist hopes to find a gene gene in human liver cells that codes for an important blood clotting protein. He knows that the nucleotides sequence of a small part of the gene is GTGGACTGACA. briefly explain how to obtain the desired genearrow_forward
- ) A normal mRNA that reads 5'- UGCCAUGGUAAUAACACAUGAAGGCCUGAAC-3' was an insertion mutation that changes the sequence to 5'- UGCCAUGGUUAAUAACACAUGAGGCGUGAAC-3'. Translate the original mRNA and the mutated mRNA and explain how insertion mutations can have dramatic effects on proteins. ( Hint; Be sure to find the initiation site).arrow_forwarda. Some antibiotics, such as rifampin, interfere with the function of RNA polymerase. What biological process is rifampin disrupting? b. Some antibiotic-resistant M. tuberculosis bacteria have a single point mutation (CàT) in the rpoB gene that causes an amino acid change from serine (a polar amino acid) to leucine (a non-polar amino acid). What type of mutation is this? Do you expect this to have no effect, a small effect, or a large effect on the polypeptide produced? Explain your reasoning. c. The rpoB gene encodes a subunit of the bacterial RNA polymerase protein. The point mutation described in Question 2 causes a change in protein folding, which leads to the inability of the rifampin antibiotic to bind to the RNA polymerase. Which level(s) of protein structure is/are affected by this change?arrow_forwardRefer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)arrow_forward
- After Drosophila DNA has been treated with a restrictionenzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun”technique, every DNA sequence of Drosophila in a librarycan be recovered.a. How would you identify a clone that contains DNAencoding the protein actin, whose amino acid sequenceis known?b. How would you identify a clone encoding a specifictRNAarrow_forwardBelow is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?arrow_forwardDuchenne muscular dystrophy is caused by a mutation in a gene that comprises 2.5 million base pairs and specifies a protein called dystrophin. However, less than 1% of the gene actually encodes the amino acids in the dystrophin protein. On the basis of what you now know about gene structure and RNA processing in eukaryotic cells, provide a possible explanation for the large size of the dystrophin gene.arrow_forward
- Given: eukaryotic cells can make different proteins, using only one gene. How can a eukaryotic cell make different final proteins from the same gene? Note: some of the answers are actually correct statements, but they don't have anything to do with this question. A.Eukaryotes have 3 RNA polymerases instead of just one. B.Eukaryotes cannot perform simultaneous transcription and translation. C.Eukaryotes splice RNA and can do so in various arrangements. D.Eukaryotes lack the Shine Delgarno sequence.arrow_forwardThis problem investigates issues encountered in sequencing the inserts in cDNA libraries.a. If you sequenced many clones individually, wouldn’tyou spend many of your resources inefficiently sequencing cDNAs for the same type of mRNA molecule over and over again? Explain. Does thisapparently inefficient process provide any useful information beyond the sequences of individual mRNAs?b. Suppose that you identified a clone with a cDNA insert that was 4 kb long. You could determine the entire sequence of the clone by shearing the DNA intosmall random fragments, cloning these fragments intoa vector to make a mini-shotgun library, and then sequencing hundreds of these clones to allow the computer to assemble the full sequence of the 4 kb–longinsert. However, this procedure would be inefficient.An alternative that requires many fewer sequencing reactions is called primer walking. This techniqueinvolves the synthesis of additional oligonucleotideprimers corresponding to cDNA sequences you…arrow_forwardYou want to clone the Human Gene A into a plasmid for producing the Protein A in bacteria. GeneA encodes an mRNA of 100 nucleotides long, but the entire gene spans more than 4000 nucleotides. There are three exons and two introns. If we were to clone this gene directly from the nuclear DNA, bacteria would not be able to express the insulin protein. Explain why this is true.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Embryology | Fertilization, Cleavage, Blastulation; Author: Ninja Nerd;https://www.youtube.com/watch?v=8-KF0rnhKTU;License: Standard YouTube License, CC-BY