Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 1EQ
Two circular DNA molecules, which we can call molecule A and molecule B, are topoisomers of each other. When viewed under the electron microscope, molecule A appears more compact than molecule B. The level of gene transcription is much lower for molecule A. Which of the following three possibilities could account for these observations?
First possibility: Molecule A has three positive supercoils, and molecule B has three negative supercoils.
Second possibility: Molecule A has four positive supercoils, and molecule B has one negative supercoil.
Third possibility: Molecule A has zero supercoils, and molecule B has three negative supercoils.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In some organisms, UV-induced thymine dimers can be repaired by photoreactivation, in which energy from visible light is used to split the bonds forming the cyclobutane ring ? true or false
Non-homologous end joining occurs when enzymes cut out a few nucleotides around a double strand DNA break, and then fuse the ends back together (right) true or false?
The region of the normal hemoglobin gene used for genetic testing for sickle cell anemia contains a restriction site such that homozygous normal individuals show two DNA fragments. If a single nucleotide change in hemoglobin destroys that restriction site, then how many DNA fragments will be visible on a gel from individuals that are homozygous mutant? What about heterozygotes?
What results would be expected in the experiment outlined in Figure if, during replication, all the original histone proteins remained on one strand of the DNA and new histones attached to the other strand?
Chapter 10 Solutions
Genetics: Analysis and Principles
Ch. 10.1 - 1. A bacterial chromosome typically contains
a. a...Ch. 10.2 - Mechanisms that make the bacterial chromosome more...Ch. 10.2 - 2. Negative supercoiling may enhance activities...Ch. 10.2 - 3. DNA gyrase
a. promotes negative supercoiling....Ch. 10.3 - 1. The chromosomes of eukaryotes typically contain...Ch. 10.4 - Which of the following is an example of a...Ch. 10.5 - What are the components of a single nucleosome? a....Ch. 10.5 - 2. In Noll’s experiment to test the...Ch. 10.5 - Prob. 3COMQCh. 10.5 - Prob. 4COMQ
Ch. 10.6 - Prob. 1COMQCh. 10.6 - 2. The role of cohesin is to
a. make chromosomes...Ch. 10 - Prob. 1CONQCh. 10 - Prob. 2CONQCh. 10 - 3. Describe the mechanisms by which bacterial DNA...Ch. 10 - Why is DNA supercoiling called supercoiling rather...Ch. 10 - Prob. 5CONQCh. 10 - Prob. 6CONQCh. 10 - Prob. 7CONQCh. 10 - Prob. 8CONQCh. 10 - Prob. 9CONQCh. 10 - 10. What is the function of a centromere? At what...Ch. 10 - Prob. 11CONQCh. 10 - 12. Describe the structures of a nucleosome and a...Ch. 10 - Beginning with the G1 phase of the cell cycle,...Ch. 10 - Draw a picture depicting the binding between the...Ch. 10 - 15. Compare heterochromatin and euchromatin. What...Ch. 10 - 16. Compare the structure and cell localization of...Ch. 10 - 17. What types of genetic activities occur during...Ch. 10 - Lets assume the linker region of DNA averages 54bp...Ch. 10 - 19. In Figure 10.12, what are we looking at in...Ch. 10 - 20. What are the roles of the core histone...Ch. 10 - A typical eukaryotic chromosome found in humans...Ch. 10 - Which of the following terms should not be used to...Ch. 10 - Discuss the differences between the compaction...Ch. 10 - 24. What is an SMC complex? Describe two...Ch. 10 - Two circular DNA molecules, which we can call...Ch. 10 - 2. Let’s suppose you have isolated DNA from a cell...Ch. 10 - 3. We seem to know more about the structure of...Ch. 10 - In Nolls experiment of Figure 10.11, explain where...Ch. 10 - When chromatin is treated with a salt solution of...Ch. 10 - 6. Let’s suppose you have isolated chromatin from...Ch. 10 - If you were given a sample of chromosomal DNA and...Ch. 10 - Consider how histone proteins bind to DNA and then...Ch. 10 - In Chapter 23, the technique of fluorescence in...Ch. 10 - Bacterial and eukaryotic chromosomes are very...Ch. 10 - The prevalence of highly repetitive sequences...Ch. 10 - Discuss and make a list of the similarities and...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?arrow_forwardIn the Meselson-Stahl experiment on DNA replication, what fraction of the DNA was composed of one light strand and one heavy strand ("hybrid") after one generation of growth in medium containing 14N? After two generations of growth in a medium containing 14N? What fraction of hybrid DNA is expected after n generations of growth in a medium containing 14N?arrow_forwardWhy do we say replication and transcription is highly stochastic? There are just 4 types of nucleotdes, the probability is not simply 1/4 at each step?arrow_forward
- . Which of the following enzymes can break, and rejoin, phosphodiester bonds during the normal DNA replication process in the chromosomes of E. coli cells? single-stranded binding proteins RNA polymerase topoisomerase DNA helicase DNA ligase The mutation causing sickle-cell anemia in humans, which changes the normal T to an A in the sixth codon (substituting valine for glutamic acid), occurs in which gene of the hemoglobin family? the a-globin gene (alpha) the b-globin gene (beta) the g-globin gene (gamma) the d-globin gene (delta) the e-globin gene (epsilon) The hypermutable condition, which allows cells to “play the lottery” by lowering the fidelity of DNA replication, was first discovered in which of the following prokaryotes? Saccharomyces cerevisiae Amoeba dubia Drosophila melanogaster Homo sapiens Escherichia coliarrow_forwardSuppose that a bacterial DNA molecule is given a left-handed twist.How does this affect the structure and function of the DNA?arrow_forwardBelow is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…arrow_forward
- In one, simple sentence define the function of the following 1. Helicase = 2. Alpha subunit of DNA polymerase III =arrow_forwardWhat enzymatic features of DNA polymerase prevent it from replicating one of the DNA strands at the ends of linear chromosomes? Compared with DNA polymerase, how is telomerase different in its ability to synthesize a DNA strand? What does telomerase use as its template for the synthesis of a DNA strand? How does the use of this template result in a telomere sequence that is tandemly repetitive?arrow_forwardIn the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.arrow_forward
- In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region. 4C. In NOT more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus?arrow_forwardHow is it possible to generate so many products from a DNA that is able to fit inside the nucleus of a very small cell?arrow_forwardAflatoxin B1 is a highly mutagenic and carcinogenic compound produced by certain fungi that infect crops such as peanuts. Aflatoxin is a large, bulky molecule that chemically bonds to the base guanine (G) to form the aflatoxin-guanine adduct that is pictured below. In the figure below, the aflatoxin is orange, and the guanine base is purple. This adduct distorts the DNA double helix and blocks replication. a. What type(s) of DNA repair system is (are) most likely to be involved in repairing the damage caused by exposure of DNA to aflatoxin B1? b, Recent evidence suggests that the adduct of guanine and aflatoxin B1 can attack the bond that connects it to deoxyribose; this liberates the adducted base, forming an apurinic site. How does this new information change your answer to part (a)?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY