The effect of a mutation in an allosteric enzyme that resulted in a T/R ratio of 0 is to be stated. Concept introduction: Enzymes being the catalysts increase the rate of reaction . In an enzyme-catalyzed reaction, the rate of reaction for the product formation depends on the concentration of enzyme as well as the substrate involved in the reaction via formation of an enzyme substrate complex.The enzyme which is able to do the conformational changes if an effector gets attached to it is known as allosteric enzyme.

Question

Want to see the full answer?

Answer 1

Question

Chapter 10, Problem 7P

Interpretation Introduction

Interpretation:

The effect of a mutation in an allosteric enzyme that resulted in a T/R ratio of 0 is to be stated.

Concept introduction:

Enzymes being the catalysts increase the rate of reaction. In an enzyme-catalyzed reaction, the rate of reaction for the product formation depends on the concentration of enzyme as well as the substrate involved in the reaction via formation of an enzyme substrate complex.The enzyme which is able to do the conformational changes if an effector gets attached to it is known as allosteric enzyme.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

I. A protein, X, was Isolated from a pathogenlc mlcroorganism. The proteln Is a vlrulence factor whose path0genlclty lies In a heptapeptide of unknown sequence. After trypsin cleavage of the heptapeptide from protein X, the peptlde's compOsition and sequence was determined. The fOllowing were the results of the sequenclng process: 1. When the peptide was treated with dinitrofluorobenzene (DNFB), DNP-asp and a mixture of amino acids were produced. 2. When the same Intact peptide was treated with streptococcal protease, a pentapeptide of composition asp, asN, cys, gly and ser and 2 amlno acids were released. 3. When the heptapeptlde was also treated with hydrOxylamine HCI, a tripeptide and a tetrapeptide were obtained. The C-terminal amino acid of the tripeptide was asN. 1) What is the sequence of the heptapeptide if it is composed of cys, asp, lys, asN, gly and ser only? 2) What is the pl of the heptapeptide?

GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.

Homozygosity for extremely rare mutations in a humangene called SCN9A cause complete insensitivity topain (congenital pain insensitivity or CPA) and a totallack of the sense of smell (anosmia). The SCN9A geneencodes a sodium channel protein required for transmission of electrical signals from particular nerves inthe body to the brain. The failure to feel pain is a dangerous condition as people cannot sense injuries.The SCN9A gene has 26 exons and encodes a1977-amino acid polypeptide. Consanguineous matings in three different families have resulted in individuals with CPA/anosmia. In Family 1, a G-to-Atransition in exon 15 results in a truncated protein that is898 amino acids long; in Family 2, deletion of a singlebase results in a 766-amino acid polypeptide; and inFamily 3, a C-to-G transversion in exon 10 yields a458-amino acid protein.a. Hypothesize as to how each of the three SCN9Amutations affects gene structure: Why are truncatedproteins made in each case? b. How would you…