ESSENTIALS OF GENETICS ALC & MOD MSTG/ET VP
1st Edition
ISBN: 9780134452890
Author: KLUG
Publisher: Pearson Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 11, Problem 21PDQ
Summary Introduction
To review:
The formation of a closed ring by the lambda phage DNA (deoxyribonucleic acid) in a host cell.
Introduction:
Lambda phage is an enterobacteria phage that infects Escherichia coli. It is made up of a head, a tail, and tail fibers, and the phage double-strand linear DNA is enclosed in the head. It performs both lytic and lysogenic cycles in the host. In the lytic cycle, the replication of lambda phage is followed by host cell lysis, and in the lysogenic cycle, the viral genome gets integrated into the host genome and replicates there.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Below is a diagram of the general structure of the bacteriophagel chromosome. Speculate on the mechanism by which it forms aclosed ring upon infection of the host cell.
5'GGGCGGCGACCT:double@stranded region-3'
3'- double@stranded region:CCCGCCGCTGGA5'
Define the following terms:a. histonesb. heterochromatinc. euchromatind. intergenic sequencese. tandem repeats
Define the following terms:a. Chargaff’s rulesb. constitutive heterochromatinc. bacteriophaged. replication-dependent histonese. replication-independent histones
Chapter 11 Solutions
ESSENTIALS OF GENETICS ALC & MOD MSTG/ET VP
Ch. 11 - CASE STUDY | Art inspires learning A genetics...Ch. 11 - Prob. 2CSCh. 11 - Prob. 3CSCh. 11 -
HOW DO WE KNOW?
1. In this chapter, we focused on...Ch. 11 - Review the Chapter Concepts list on p. 199. These...Ch. 11 - Prob. 3PDQCh. 11 - Describe how giant polytene chromosomes are...Ch. 11 - What genetic process is occurring in a puff of a...Ch. 11 - Prob. 6PDQCh. 11 - Why might we predict that the organization of...
Ch. 11 -
8. Describe the sequence of research findings...Ch. 11 - Prob. 9PDQCh. 11 - Prob. 10PDQCh. 11 - Provide a comprehensive definition of...Ch. 11 - Prob. 12PDQCh. 11 - Define satellite DNA. Describe where it is found...Ch. 11 - Prob. 14PDQCh. 11 -
15. Mammals contain a diploid genome consisting...Ch. 11 - Prob. 16PDQCh. 11 - Prob. 17PDQCh. 11 - Prob. 18PDQCh. 11 - Prob. 19PDQCh. 11 - The human genome contains approximately 106 copies...Ch. 11 - Prob. 21PDQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Explain, with the aid of a hand drawn diagram, the life cycle of bacteriophage T4.arrow_forwardThe sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forwardA particular variant of the lambda bacteriophage has a DNA double-stranded genome of 51,365 base pairs. How long would this DNA be?arrow_forward
- One genetic map unit (cM) is equal to a recombination frequency of a. 1 % b. 0.1 % c. 10 % d. 50 % e. 1 ppmarrow_forwardDescribe how each of the following bacteriophages M 13, G4 and bX174 initiate DNA replicationarrow_forwardIn bacteriophages and bacteria, the DNA is almost always organized into circular (closed loops) chromosomes. Phage l is an exception, maintaining its DNA in a linear chromosome within the viral particle. However, as soon as this DNA is injected into a host cell, it circularizes before replication begins. What advantage exists in replicating circular DNA molecules compared to linear molecules, characteristic of eukaryotic chromosomes?arrow_forward
- Bacteriophage T4 has a linear double-stranded DNA genome, yet mapping many mutations, as shown in Figure, generates a circular linkage map. How might you explain this discrepancy?arrow_forwardA chromosome from a multicellular slime mold called purple oblex (Plasmodiophora oblexii) is 13% adenine (A), what is the percentage of guanine (G)?arrow_forwardGiven the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?arrow_forward
- A closed circular plasmid B-DNA (10.5 bp/turn) consists of 231 base pairs and has Wr= -1 (ccDNAa). Then a topoisomerace acts upon ccDNAa leading to strain relaxation caused by supercoiling, thus, a topoisomere ccDNAb is formed. Finally, EtBr (Ethidium bromide) intercalator is added leading to ccDNAc which has 11bp/turn. a) Calculate superhelical densities σa, σb, σc of the three plasmids ccDNAa, ccDNAb and ccDNAc, respectively. b) Which of the three topoisomeres will move faster in agarose gel electrophoresis and why?arrow_forwardTranscribe and translate the following DNA sequence of the coding strand: 5'-ATGGCCCGGTTATAAGCA-3'arrow_forwardMethylated cytosines may be associated with a. telomere repeats b. mutation hotspots c. centromere regions d. rancid breakfast cereal e. euchromatinarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License