![Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)](https://www.bartleby.com/isbn_cover_images/9780135564172/9780135564172_largeCoverImage.gif)
Concept explainers
Thinking back to the discussion of gain
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 11 Solutions
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
- Leber Congenital Amaurosis (LCA) causes progressive vision loss due to defects in the gene that encodes RPE65 isomerase. Affected individuals are homozygous recessive for mutant alleles of the RPE65 gene. You are trying to determine the molecular nature of the mutations in three individuals with LCA. For ease of analysis, you may assume that each individual is homozygous for the same mutant allele (though the three individuals have different mutations than each other). You use the polymerase chain reaction to amplify DNA from each patient and you determine the sequence of the DNA and compare it to unaffected individuals. You identify the following differences. Note that the non-template strand of DNA is given and the changes are highlighted using red boldface. You can assume that the sequences are in the first reading frame (eg. the first three nucleotides of each sequence is a codon). The coding region of the gene is 1602 bp and the position of the sequences shown below is…arrow_forwardName three different types of loss of function mutations and in each case explain how the mutation exerts a loss of function effect on a genearrow_forwardDiamond–Blackfan anemia (DBA) is a rare, dominantgenetic disorder characterized by bone marrow malfunction,birth defects, and a predisposition to certaincancers. Infants with DBA usually develop anemia in the firstyear of life, have lower than normal production of red blood cellsin their bone marrow, and have a high risk of developing leukemiaand bone cancer. At the molecular level, DBA is causedby mutations in any one of 10 genes that encode ribosomalproteins. The first-line therapy for DBA is steroid treatment,but more than half of affected children develop resistance tothe drugs and in these cases, treatment is halted. DBA can betreated successfully with bone marrow or stem cell transplantsfrom donors with closely matching immune system markers.Transplants from unrelated donors have significant levels ofcomplications and mortality. Given that a faulty ribosomal protein is the culprit and causesDBA, discuss the possible role of normal ribosomal proteins.Why might bone marrow cells be…arrow_forward
- Which form of Retinoblastoma typically results in unilateral disease and exhibits 2-hit mutational kinetics?arrow_forwardDiamond–Blackfan anemia (DBA) is a rare, dominantgenetic disorder characterized by bone marrow malfunction,birth defects, and a predisposition to certaincancers. Infants with DBA usually develop anemia in the firstyear of life, have lower than normal production of red blood cellsin their bone marrow, and have a high risk of developing leukemiaand bone cancer. At the molecular level, DBA is causedby mutations in any one of 10 genes that encode ribosomalproteins. The first-line therapy for DBA is steroid treatment,but more than half of affected children develop resistance tothe drugs and in these cases, treatment is halted. DBA can betreated successfully with bone marrow or stem cell transplantsfrom donors with closely matching immune system markers.Transplants from unrelated donors have significant levels ofcomplications and mortality. While a stem cell transplant from an unaffected donor is currentlythe only cure for DBA, genome-editing technologies mayone day enable the correction of…arrow_forwardThe following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairingarrow_forward
- Explain the difference between a gain-of-functionmutation and a dominant-negative mutation. Why areboth these types of mutation usually dominant?arrow_forwardDiscuss the consequences of a germ-line versus a somatic mutation.arrow_forwardBased on the information in Figure, which single-nucleotide mutationevent is more likely: Arg-to-His, or Arg-to-Ser? Explain.arrow_forward
- Silent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. 1) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?arrow_forwardThe genetic alteration responsible for sickle-cell anemia in humans involves: a transition mutation from A to G, substituting glutamic acid for valine in a-globin a transversion mutation from T to A, substituting valine for glutamic acid in b-globin a transition mutation from T to C, substituting valine for glutamic acid in b-globin a transversion mutation from G to C, substituting glutamic acid for valine in a-globin a frameshift mutation of one ATC codon, removing glutamic acid from b-globinarrow_forwardThe table below shows different types of mutations in different positions in four genes. Choose the letter (A to E), from the drop-down menu, that represents the most likely type of protein that will be produced from each of these mutated genes. A: completely normal protein B: functional protein with ONE amino acid different from normal C: non-functional protein with ONE amino acid different from normal D: non-functional protein with MANY amino acids different from normal E: no protein at all Answer Type of mutation Position of mutation in gene (A, B, C, D, or E) before the part of the gene that specifies the active site of the enzyme 2 base pair insertion Inonsense immediately before the stop codon in the part of the gene that specifies the active site of the enzyme silent 1 base pair insertion in an intronarrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)