Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
3rd Edition
ISBN: 9780135564172
Author: Mark Sanders, John Bowman
Publisher: PEARSON+
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 11, Problem 14P

Several types of mutation are identified and described in the chapter. These include (1) promoter mutation, (2) splice site mutation, (3) missense mutation, (4) frameshift mutation, and (5) nonsense mutation. Match the following mutation descriptions with the type(s) of mutation listed above. More than one mutation type might match a description.

a. A mutation that changes several amino acids in a protein that is shorter than the wild - type product.

b. A mutation that produces about 5% of the wild - type amount of an mRNA.

c. A mutation that produces a mutant protein that differs from the wild - type protein at one amino acid position.

d. A mutation that produces a protein that is shorter than the wild - type proteinbut does not have any amino acid changes in the protein produced.

e. A null mutation that does not produce any functional protein product.

Blurred answer
Students have asked these similar questions
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein.    Wild Type DNA Sequence:  3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence:    3' - AGTCTCGCCTGT - 5'
The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics? (Explain in details)

Chapter 11 Solutions

Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)

Ch. 11 - 11.11 Two different mutations are identified in a...Ch. 11 - What is the phenotype effect of inserting a Ds...Ch. 11 - 11.13 Answer the following questions concerning...Ch. 11 - Several types of mutation are identified and...Ch. 11 - 11.15 A sample of the bacterium is exposed to...Ch. 11 - 11.16 A strain of is identified as having a null...Ch. 11 - Describe the difference between DNA transposons...Ch. 11 - 11.18 How are flanking direct repeat sequences...Ch. 11 - 11.19 Using the adeninethymine base pair in this...Ch. 11 - The partial amino acid sequence of a wild-type...Ch. 11 - Prob. 21PCh. 11 - 11.22 Many human genes are known to have homologs...Ch. 11 - The fluctuation test performed by Luria and...Ch. 11 - In this chapter, three features of genes or of DNA...Ch. 11 - Briefly compare the production of DNA double -...Ch. 11 - During mismatch repair, why is it necessary to...Ch. 11 - 11.27 Following the spill of a mixture of...Ch. 11 - 11.28 In an Ames test using Salmonella bacteria a...Ch. 11 - A wild - type culture of haploid yeast is exposed...Ch. 11 - A fragment of a wild - type polypeptide is...Ch. 11 - Prob. 31PCh. 11 - Alkaptonuria is a human autosomal recessive...Ch. 11 - 11.33 In an experiment employing the methods of...Ch. 11 - Using your knowledge of DNA repair pathways choose...Ch. 11 - 11.35 Ataxia telangiectasia is a human inherited...Ch. 11 - A geneticist searching for mutations uses the...Ch. 11 - 11.37 In a mousebreeding experiment a new mutation...Ch. 11 - 11.38 Considering the Dumbo mutation in a Problem,...Ch. 11 - 11.39 Thinking back to the discussion of...Ch. 11 - 11.40 Common baker’s yeast () is normally grown at...Ch. 11 - 11.41 The two gels illustrated below contain...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY