Concept explainers
To determine: The movement of primase in the lagging strand in figure 11.19.
Introduction: The process of formation of daughter strands from DNA strands is termed as replication of DNA. The enzyme RNA primer initiates the synthesis of daughter DNA strands from the template strand. The RNA primer is synthesized by an enzyme known as DNA primase. Two strands are synthesized by this enzyme. One is the leading strand while the other is the lagging strand.
To determine: Whether primase moves from left to right or from right to left.
Introduction: The process of formation of daughter strands from DNA strands is termed as replication of DNA. The enzyme RNA primer initiates the synthesis of daughter DNA strands from the template strand. The RNA primer is synthesized by an enzyme known as DNA primase. Two strands are synthesized by this enzyme. One is the leading strand while the other is the lagging strand.
To determine: The way in which primase must move after it is done making a primer and has to start making the next primer at a new location.
Introduction: The process of formation of daughter strands from DNA strands is termed as replication of DNA. The enzyme RNA primer initiates the synthesis of daughter DNA strands from the template strand. The RNA primer is synthesized by an enzyme known as DNA primase. Two strands are synthesized by this enzyme. One is the leading strand while the other is the lagging strand.
To determine: Whether primase has to hop from left to right or right to left direction.
Introduction: The process of formation of daughter strands from DNA strands is termed as replication of DNA. The enzyme RNA primer initiates the synthesis of daughter DNA strands from the template strand. The RNA primer is synthesized by an enzyme known as DNA primase. Two strands are synthesized by this enzyme. One is the leading strand while the other is the lagging strand.
Want to see the full answer?
Check out a sample textbook solutionChapter 11 Solutions
BIOLOGY (LL)
- Can you explain it?arrow_forwardApplication/ Analysis Explain how the anti-parallel structure of DNA predicts its replication mechanism. Identify the major and minor groove of DNA and explain why they are there. Differentiate between semiconservative, conservative, and dispersive replication. Interpret a diagram of a bi-directional replication fork and correctly determine strand polarity and fork direction.arrow_forwardQuick help Only cell biology Which process is described in the following paragraph? During DNA synthesis, before the enzyme adds the next nucleotide to a growing DNA strand, it checks whether the previously added nucleotide is correctly base-paired to the template strand. If so, the polymerase adds the next nucleotide; if not, the polymerase clips off the mispaired nucleotide and tries again. This is carried out by cleaving the phosphodiester backbone using the enzyme’s 3’-to-5’ exonuclease activity.arrow_forward
- Discuss Concepts During replication, an error uncorrected by proofreading or mismatch repair produces a DNA molecule with a base mismatch at the indicated position: The mismatch results in a mutation. This DNA molecule is received by one of the two daughter cells produced by mitosis. In the next round of replication and division, the mutation appears in only one of the two daughter cells. Develop a hypothesis to explain this observation.arrow_forwardMultiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram illustrating replication of the circular E. coli chromosome (a) at an early stage, (b) when one-third completed, (c) when two-thirds completed, and (d) when almost finished, assuming the initiation of replication at oriC has occurred only once. Then, draw a diagram showing the E. coli chromosome in problem 3 where the E. coli cell is dividing every 20 minutes.arrow_forwardNumber of Okazaki Fragments in E. coli and Human DNA Replication Approximately how many Okazaki fragments are synthesized in the course of replicating an E. coli chromosome? How many in replicating an “average� human chromosome?arrow_forward
- Do allarrow_forwardMatching Type Choose the directionality of the given process. (4 points) What is the directionality of the given process? * 4 points 3'-5' 5'-3' Exonuclease activity Complementary strand of the continuous strand Addition of nucleotides going to the replication fork Addition of nucleotides away from the replication forkarrow_forwardCentral Dogma Application: Using the basic concept of Process of central dogma provide the following answer in the given DNA sequence on how genetic information flow. IV. Given DNA Sequence: ATCGATCGCGATCGATTACATATGCGCCCCTTTTTCCCGGGAATAATGCTAGCTAGCATGCATCAG Product of Replication: ( Product of Transcription: Product of Translation: {.arrow_forward
- B PLEASE second onearrow_forwardReplication:- what other enzymes are involved in the initiation phase?- explain the role of primers in this phase- how is the building of the leading strand different from that of the lagging strand?arrow_forwardQuestion. What would the forward primer sequence look like if it were intended to bind the area of the DNA template?arrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning