Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 22CONQ
Do the following events during bacterial translation occur primarily within the 30S subunit, within the 50S subunit, or at the interface between these two ribosomal subunits?
A. mRNA-tRNA recognition
B. Peptidyl transfer reaction
C. Exit of the polypeptide from the ribosome
D. Binding of initiation factors IF1, IF2, and IF3
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
If we watched a eukaryotic cell initiate translation, one of the first things we would see is
a.
The small ribosomal subunit binding to the cap
b.
The formation of the 70s initiation complex
c.
The small ribosomal subunit binding to the Shine-Dalgarno sequence
d.
The formation of the 80s initiation complex
In EUKARYOTIC translation, how does initiation of translation occur?
a) What components of the mature mRNA are involved (2 components) and
b) what proteins are involved (at least 2 proteins)?
Tetracycline antibiotics bind to the A site on the bacterial ribosome and prevent further translation. Where would you expect polypeptides to accumulate on tetracycline-inhibited ribosomes? Given what tetracycline does, how does this effect cause the bacterial cell to die?
Chapter 13 Solutions
Genetics: Analysis and Principles
Ch. 13.1 - Prob. 1COMQCh. 13.1 - 2. The reason why Beadle and Tatum observed four...Ch. 13.2 - What is the genetic code? a. The relationship...Ch. 13.2 - Prob. 2COMQCh. 13.2 - The fourth codon in an mRNA sequence is GGG, which...Ch. 13.2 - Prob. 4COMQCh. 13.3 - Prob. 2COMQCh. 13.4 - Prob. 1COMQCh. 13.4 - 2. The anticodon of a tRNA is located in the
a....Ch. 13.4 - An enzyme known as _______attaches an amino acid...
Ch. 13.5 - Each ribosomal subunit is composed of a. multiple...Ch. 13.5 - Prob. 2COMQCh. 13.6 - 1. During the initiation stage of translation in...Ch. 13.6 - The Kozak rules determine a. the choice of the...Ch. 13.6 - During the peptidyl transfer reaction, the...Ch. 13.6 - A release factor is referred to as a molecular...Ch. 13 - Prob. 1CONQCh. 13 - What does it mean when we say that the genetic...Ch. 13 - According to the adaptor hypothesis, is each of...Ch. 13 - Prob. 4CONQCh. 13 - Prob. 5CONQCh. 13 - 6. The wobble rules for tRNA-mRNA pairing are...Ch. 13 - Prob. 7CONQCh. 13 - Prob. 8CONQCh. 13 - Prob. 9CONQCh. 13 - If a tRNA has an anticodon sequence 3CCI5, what...Ch. 13 - Describe the anticodon of a single tRNA that could...Ch. 13 - Prob. 12CONQCh. 13 - Prob. 13CONQCh. 13 - 14. What is the role of aminoacyl-tRNA synthetase?...Ch. 13 - Prob. 15CONQCh. 13 - 16. Discuss the significance of modified bases...Ch. 13 - How and when does formylmethionine become attached...Ch. 13 - Prob. 18CONQCh. 13 - Prob. 19CONQCh. 13 - Prob. 20CONQCh. 13 - The term subunit can be used in a variety of ways....Ch. 13 - 22. Do the following events during bacterial...Ch. 13 - 23. What are the three stages of translation?...Ch. 13 - Prob. 24CONQCh. 13 - 25. For each of the following initiation factors,...Ch. 13 - Prob. 26CONQCh. 13 - 27. For each of the following sequences, rank them...Ch. 13 - Prob. 28CONQCh. 13 - Prob. 29CONQCh. 13 - Prob. 30CONQCh. 13 - Prob. 31CONQCh. 13 - In which of the ribosomal sites, the A site, P...Ch. 13 - Prob. 33CONQCh. 13 - Prob. 34CONQCh. 13 - Prob. 35CONQCh. 13 - Prob. 36CONQCh. 13 - Prob. 37CONQCh. 13 - 1. In the experiment of Figure 13.7, what would be...Ch. 13 - 2. Polypeptides can be translated in vitro. Would...Ch. 13 - Discuss how the elucidation of the structure of...Ch. 13 - Describe the structure of a polysome, which is...Ch. 13 - Prob. 5EQCh. 13 - 6. The technique of Western blotting is described...Ch. 13 - The protein known as tyrosinase is needed to make...Ch. 13 - Prob. 8EQCh. 13 - Discuss why you think the ribosomes need to...Ch. 13 - 2. Discuss and make a list of the similarities...Ch. 13 - 3. Which events during translation involve...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The primary function of RF1 during translation is to: a. recognize a stop codon in the 70S A site during termination. b. recognize the start codon in the 70S P site during initiation. c. move tRNAs and mRNA through the ribosome during elongation. d. facilitate binding of the ribosome to mRNA during initiation.arrow_forwardThe release factors RF1 and RF2 are required for a. translation termination b. the realease of the aminoacid from the tRNA c. translation elongation d. translation initiationarrow_forward1. Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the role of tRNA molecules in protein translation.c. Define the following terms:1. codon 2. anticodon. Explain how a codon is used in the process of translation.arrow_forward
- Put the following processes in order of their occurrence during expression of a eukaryotic gene: a. mRNA processing c. transcription b. translation d. RNA leaves nucleusarrow_forwardWhat would be the direct consequence to a cell of loss-of-function of Elongation Factor-Tu (EF-Tu)? You may select multiple answers. a. tRNAs would fail to exit the E site after giving up their amino acid. b. The error rate of translation would increase. c. The ribosome would frequently fail to identify the correct start codon and initiation of translation would become less efficient. d. There would be no pause between the entry of a tRNA into the A site and peptidyl transfer.arrow_forwardWhich of the following statements best describes the initiation of translation? A) The large and small ribosomal subunits scan the mRNA in the 3'–5' direction until the promoter is reached. B) A tRNA with the anticodon, AUG, enters the ribosomal complex and binds to the mRNA at the A site. C) The mRNA containing the start codon, AUG, sits at the P site and forms a complex with the corresponding tRNA, and the large and small ribosomal subunits. D) The mRNA attaches to the large ribosomal subunit and once the start codon reaches the A site, the tRNA binds and the small subunit completes the complex.arrow_forward
- Describe the prokaryotic translation initiation shown in the diagram. Define the convention of protein synthesis (directionality of synthesis) as well as the meaning of the A, P, and E sites of the ribosome.arrow_forwardThe Kozak rules determine a. the choice of the start codon in complex eukaryotes. b. the choice of the start codon in bacteria. c. the site in the mRNA where translation ends. d. how fast the mRNA is translated.arrow_forwardDuring translation, when a stop codon is read on the mRNA strand at the ribosome... a the mRNA is digested by a protease complex b a repressor attached to the ribosome that inhibits the movement of the ribosome along the mRNA c the enzyme helicase binds to terminate the polypeptide d a release factor enters the A site of the ribosome and stimulates the disassembly of the translation complex Codons are... a triplets coding for a single amino acid. b redundant in their coding for various amino acids. c matched with anticodons during translation d triplets found on transfer RNA Question 6 (1 point) In order to produce many copies of the same protein in a short period of time, the cell uses... a intron self-splicing. b many RNA polymerase molecules to produce multiple mRNA transcripts at the same time. c single-unit ribosomes for high speed translation. d codon-anticodon reciprocal…arrow_forward
- When the amino acid levels in eukaryotic cells are low, general protein synthesis is reduced. Gcn4 translation, however, is increased. A. Why? B. In general, what is the mechanism by which Gcn4 levels are increased? C. What would happen under high and low amino acid conditions if only one of the upstream ORFs were deleted from Gcn4? D. What would happen under high and low amino acid conditions if all of the upstream ORFs were deleted from Gcn4?arrow_forwardWhat is one function of the 5' cap in eukaryotic mRNA? Select one: a. It is involved in translation termination. b. It is an intron splicing signal. c. It is the initial attachment site for ribosomes. d. It is involved in polyadenylation of the 5' end of the mRNAarrow_forwardWe have a eukaryotic full-length mRNA molecule consisting of 33 bp5ʹ -... ACGAUACGUAUGCUCGAGAUCCGAGACUAUGUU ...- 3ʹ a) What are the first five amino acids that are translated? b) Describe how the ribosome finds the translation start on the mRNA transcript from prokaryotic and eukaryotic genes, respectively.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license