![Genetics: From Genes to Genomes, 5th edition](https://www.bartleby.com/isbn_cover_images/9780073525310/9780073525310_largeCoverImage.gif)
Concept explainers
a.
To determine:
The method of entry of a transposon into the bacteria and the identification of new insert.
Introduction:
A plasmid consists of
b.
To determine:
The use of plasmid as a mutagen.
Introduction:
Plasmid fingerprinting is performed in many organisms like Escherichia coli, Salmonella, Campylobacter, and Pseudomonas strains and this technique has been proved to be more accurate than other
c.
To determine:
The identification of the affected gene that is defective in plaque formation.
Introduction:
Viruses can be defined as acellular organisms that are obligate intracellular
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 13 Solutions
Genetics: From Genes to Genomes, 5th edition
- Many resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer. A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing. Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance: > putative antibiotic resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG…arrow_forwardA shuttle vector is a vector (usually a plasmid) constructed so that it can propagate in two different host species. One of the most common types of shuttle vectors is the yeast shuttle vector. Examples of such vectors derived from yeast are Yeast Episomal Plasmid (YEP), Yeast Integrating Plasmid (YIP) and Yeast Replicating Plasmid (YRP). Why is YEP preferred over YIP and YRP? Give your thoughts on this.arrow_forwardA) Outline the experimental procedure for cloning a eukaryotic gene and expressing it in E. coli. Focus on the essential steps starting with eukaryotic gene amplification to transformation of E. coli cells B) Explain how insertional inactivation can help you identify the colonies that carry the plasmid with your eukaryotic gene of interest C) Plasmids containing antibiotic resistance genes are widely used in gene cloning and other molecular biology techniques. What would happen if the eukaryotic gene was inserted into an antibiotic resistance gene on the plasmid?arrow_forward
- Bacterial plasmids often serve as cloning vectors. Describe the essential features of a plasmid vector.arrow_forwardIt is desired to isolate genomic DNA from liquid culture of S. cerevisiae yeast. A commercial kit will be used to isolate genomic DNA from this liquid culture. Answer the following questions to understand the strategy used by commercial kits for genomic DNA isolation. a) List all the steps from cell pellet preparation to DNA elution. b) With which feature can the membrane in the column that comes with the commercial kit bind DNA? c) Which component in the kit would you use to recover the DNA from the membrane of the column to which the DNA was attached?arrow_forwardYou have set up a recombinant DNA experiment using the plasmid PBR322 as the vector (see plasmid below). You use the BamHI restriction site on the plasmid to insert the target DNA. The plasmid is then used to transform E.coli colls Is the following statement True or False? Growth of the transformed cells on agar containing both ampicillin and tetracycline will eliminate any cells that do not contain a plasmid. Clal Hindlll EcoRI Pvul BamHI Pstl amp tet PBR322 -Sall ori rop Pvull True Falsearrow_forward
- In bacterial transformation, the purpose of having antibiotic within an agar plate is to: Select one: confirm which plasmids been have successfully ligated with a gene of interest. isolate bacteria which have been successfully transformed with the plasmid. indicate which plasmids were successfully digested by the endonuclease. act as a substrate which will be cleaved and produce a blue product when ligation is unsuccessful. show which plasmids contain the lacZ gene.arrow_forwardNow that you’ve isolated the gene and made lots of copies, you need to insert the gene into something you can manipulate and move into your lab strain of E. coli. You have access to the following vectors, either pBR322 or pUC19 (look them up here to see a map https://www.neb.com/products/dna-plasmids-and-substrates Please note the restriction sites in BOLD appear only once in the plasmid). You may use either vector. What is a vector? Which vector did you choose? Explain why you made that choice. What enzyme(s) will you use to place your fragment into the vector? Explain why you chose these enzymes. How will you move this construct into coli? What phenotype will tell you if the coli have taken up the plasmid? What phenotype will tell you if the coli have taken up the plasmid with the gasP gene?arrow_forwardWe transformed E coli cells with a plasmid modified to contain a ‘virulence factor’ which would allow growth on media containing the antibiotic kanamycin (Kan). The plasmid confers constitutive resistance to ampicillin (Amp). The bacterial experiment is about understanding whether such a ‘virulence factor’ confers physiological adaptation to Kan or whether the development of resistance can be explained by random mutations. For each independent transformation we re-suspended the cells from three colonies in Luria broth. For each suspension of cells we plated 100 microliters on a Kan plate. To estimate the number of cells seeded on each Kan plate we made four serial dilutions that were plated on Amp plates (1 – 4) and we counted the number of cells growing on them. From this we extrapolated how many cells had been seeded on the Kan plate. Then we normalised the Kan results for all the plates, assuming that every plate had been seeded with 10[5] cells. Consider two Kan plates, each with…arrow_forward
- Consider the following plasmid (size 8000 bp), with restriction sites at the positions indicated: (see image) a) This plasmid is digested with the enzymes listed below. Indicate how many fragments will begenerated in each case, and give the sizes of the fragments.PstIXhoICombination of PstI + XhoI + EcoRI (triple digest) b) Draw the banding pattern you would expect to observe if each of these digestions is loaded into a separate well of an agarose gel, and the fragments separated by electrophoresis. In the first well you load a DNA marker (M) containing fragments with sizes of 1000 bp, 2000 bp, 4000 bp and 8000 bp. c) This gel is transferred to a membrane in a Southern blot experiment, and hybridised to a radioactively labelled 200 bp probe, which anneals to the plasmid DNA at the position indicated on the diagram above. Draw the autoradiographic profile you would expect to observe for the membrane.arrow_forwardThe following DNA sequence is from a bacteriophage that infects a pathogenic bacterium and scientists want to know if this bacteriophage could prove to be a potential treatment against it. But first scientists need to discover if different strains of this pathogen have restriction endonucleases that it may use for its own protection. They try 3 different RE’s:a) EcoR1 b) HaeIII c) BamH1 Look up the recognition sequences for the 3 Res. Enzymes above and check whether the phage genome (a snippet of which is shown below) will or will not be ‘cut’. Tell me how their experiment worked out and what their conclusion was.G A A A A G G C C A C A A G G C C G T C G A C T T T T A A A A G G C C A C A T G C G G C T T T T C C G G T G T T C C G G C AG C T GA A A AT T T T C C G G T G T A C G CCarrow_forwardIn relation to the use of restriction enzymes in recombinant DNA technology, answer the following: You have accidentally torn the labels off two tubes (tube A and tube B), each containing a different plasmid, now you do not know which plasmid is in which tube. Fortunately, you have restriction maps for both plasmids, shown in Figure below. You have the opportunity to test just one sample from one of your tubes. By utilizing agarose gel electrophoresis technique, which restriction enzyme OR combination of restriction enzymes would you use in this experiment to determine which plasmid is found in which tube?. (Hint: if you use Hind III restriction enzyme you are going to get ONE single fragment with a molecular size of → 0.5+0.3+0.2+0.4+1+1 = 3.4 kb).arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)