Genetics: From Genes to Genomes, 5th edition
5th Edition
ISBN: 9780073525310
Author: Leland H. Hartwell, Michael L. Goldberg, Janice A. Fischer, Leroy Hood, Charles F. Aquadro
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 7P
High salt concentrations tend to cause protein aggregation. Suggest a way to identify proteins normally expressed in particular bacterial species that can retain their solubility despite high salt conditions.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
High salt concentrations tend to cause protein aggregation. Suggest a way to identify proteins normalexpressed in particular bacterial species that can retaintheir solubility despite high salt conditions.
Describe the function of the Bicoid protein. Explain how its ability to exert its effects in a concentration-dependent manner is a critical feature of its function.
Hand written solutions are strictly prohibited.
Chapter 13 Solutions
Genetics: From Genes to Genomes, 5th edition
Ch. 13 - Choose the phrase from the right column that best...Ch. 13 - Prob. 2PCh. 13 - Now that the sequence of the entire E. coli K12...Ch. 13 - Bacterial genomes such as that of E. coli...Ch. 13 - List at least three features of eukaryotic genomes...Ch. 13 - Describe a mechanism by which a gene could move...Ch. 13 - High salt concentrations tend to cause protein...Ch. 13 - Prob. 8PCh. 13 - A liquid culture of E. coli at a concentration of...Ch. 13 - Pick out the medium i, ii, iii, or iv onto which...
Ch. 13 - Prob. 11PCh. 13 - In two isolates one is resistant to ampicillin,...Ch. 13 - E. coli cells usually have only one copy of the F...Ch. 13 - In E. coli, the genes purC and pyrB are located...Ch. 13 - DNA sequencing of the entire H. influenzae genome...Ch. 13 - Genes encoding toxins are often located on...Ch. 13 - a. You want to perform an interrupted-mating...Ch. 13 - Prob. 18PCh. 13 - One issue with interrupted-mating experiments such...Ch. 13 - Prob. 20PCh. 13 - Starting with an F- strain that was prototrophic...Ch. 13 - You can carry out matings between an Hfr and F...Ch. 13 - Genome sequences show that some pathogenic...Ch. 13 - Generalized and specialized transduction both...Ch. 13 - Prob. 25PCh. 13 - Prob. 26PCh. 13 - Prob. 27PCh. 13 - The sequence at one end of one strand of the...Ch. 13 - Prob. 29PCh. 13 - Suppose that you could obtain radioactively...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How can you tell if a protein is stably expressed over time by looking at a pulse-chase analysis gel with bands?arrow_forwardConsider the structure of Cro repressor protein from bacteriophage lambda E. It is a DNA binding protein, and like many sequence- specific DNA binding proteins, it must function as a homodimer Ex. Notice the mutual docking of a phenylalanine residue from each subunit into a hydrophobic pocket of the partner subunit. These hydrophobic interactions are required for dimerization. The noncovalent interactions highlighted in yellow are also required for dimerization. These interactions represent examples of: Osecondary structure O tertiary structure O quaternary structure O secondary AND quaternary structure Ⓒ tertiary AND quaternary structurearrow_forwardIn addition to in the information given in the pictures, researchers provide further descriptions for the figure stating: Players were also able to restructure b-sheets to improve hydrophobic burial and hydrogen bond quality. Automated methods have difficulty performing major protein restructuring operations to change b-sheet hydrogen-bond patterns, especially once the solution has settled in a local low-energy basin. Players were able to carry out these restructuring operations in such scenarios as strand swapping (Fig. 3) and register shifting. In one strand-swap puzzle, Foldit players were able to get within 1.1 A° of the native structure, with the top-scoring Foldit prediction being 1.4 A° away. A superposition between the starting Foldit puzzle, the top-scoring Foldit solution, and model 1 of the native NMR structure 2kpo (Protein Data Bank) are shown in Fig. 3b. Rosetta's rebuild and refine protocol, however, was unable to get within 2 A ° of the native structure (Fig. 3a, yellow…arrow_forward
- I'm conducting an experiment concerned with the binding affinity of tretinoin (all trans retinoic acid) and beta lactoglobulin. This can be accomplished by monitorization of fluorescence quenching of a tryptophanyl residue that resides in a hydrophobic pocket known as a calyx inside the protein. Generally, fluorescence quenching is classified as static or dynamic. Would fluorescence quenching be a result of amide bond formation to tryptophan from tretinoin or through another mechanism (ie FRET: Forester resonance energy transfer)? Could it be both?arrow_forwardConsider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?arrow_forwardDuring periods of starvation, translation of only vital mRNAs must occur inside a cell. Explain how eIF2 can mediate both the suppression of translation of non-essential mRNAs and ensure that essential mRNAs continues to be translated.arrow_forward
- During SDS-PAGE, glycoproteins migrate as relatively diffuse bands, whereas nonglycosylated proteins typically migrate as narrow, well-defined bands. Explain the reason for this difference in electrophoretic behavior.arrow_forwardIs there a difference in the effects of different salt solutions on protein denaturation? Why?arrow_forwardA random-sequence polyribonudeotide produced by polynudleotide phosphorylase, with CDP and ADP in a 5:1 molar ratio stimulated the incorporation of proline, histidine, threonine, glutamine, asparagine, and ly- sine in a cell-free translation system in the following proportions: 100, 23.4, 20, 3.3, 3.3, and 1.0, respectively. What does this experiment reveal about the nucleotide composition of coding triplets for these six amino acids?arrow_forward
- The amide hydrogen atoms of peptide bonds within proteins can exchange with protons in the solvent. In general, amide hydrogen atoms in buried regions of proteins and protein complexes exchange more slowly than those on the solvent-accessible surface do. Determination of these rates can be used to explore the proteinfolding reaction, probe the tertiary structure of proteins, and identify the regions of protein–protein interfaces. These exchange reactions can be followed by studying the behavior of the protein in solvent that has been labeled with deuterium ( ²H), a stable isotope of hydrogen. What two methods described in this chapter could be readily applied to the study of hydrogen– deuterium exchange rates in proteins?arrow_forwardExplain how catabolite repression depends on an activatorproteinarrow_forwardAt which solvent is yeast RNA very soluble? Explain why. At which solvent/s is yeast RNA insoluble? Explain why. . Suppose Biuret test is conducted to a solution of RNA. Will it give a positive result or not? Explain your answer. . Why is Molisch’s test used for the determination of presence of pentose in the hydrolysate? What other test could be used for this?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
TISSUE REPAIR Part 1: Repair - Regeneration; Author: ilovepathology;https://www.youtube.com/watch?v=t-5EjlS6qjk;License: Standard YouTube License, CC-BY