Life: The Science of Biology
11th Edition
ISBN: 9781319010164
Author: David E. Sadava, David M. Hillis, H. Craig Heller, Sally D. Hacker
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 13, Problem 2Q
Summary Introduction
To review:
The number of starting points that a single deoxyribonucleic acid (DNA) molecule contains, based on the given diagram and whether the number is consistent with the results of the previous question.
Given:
The radioactivity inferred by the 3H-thymidine is shown for a small section of a single DNA molecule in the following figure. The DNA has been extracted from human cells, undergoing S phase (synthetic phase) after receiving pulse with 3H-thymidine for the last 4 hours of S phase.
Figure 1: The radioactivity of a small segment of DNA after receiving a pulse of 3H-thymidine.
Introduction:
The S phase or the synthesis phase is a part of the cell cycle where the cell synthesizes or duplicates its genetic material, that is, DNA. The S phase lasts for about 8 hours in humans. Whether the duplication has taken place or not, is detected by the incorporation of the radioactive thymidine.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
If we are given this segment of DNA:
TTGGHTGUTGG
HHUUTHUGHUU
Let’s suppose this DNA was treated with nitrous acid. The nitrous acid was then removed, and the DNA replicated for two generations. What would be the sequences of the DNA products after the DNA had replicated two times? (note Hypoxanthine pairs with cytosine) and so there would be four sets?
On further analysis of the DNA described in conceptual questionC21, you discover that the triplex DNA in this alien organism iscomposed of a double helix with a third strand wound within themajor groove (just like the DNA in Figure shown). How would youpropose that this DNA is able to replicate itself? In your answer,be specific about the base-pairing rules within the double helixand which part of the triplex DNA would be replicated first.
The chromosome of E. coli contains 4.6 million bp. How long will it take to replicate its DNA? Assuming that DNA polymerase III is the primary enzyme involved and that it can actively proofread during DNA synthesis, how many base pair mistakes will be made in one round of DNA replication in a bacterial population containing 1000 bacteria?
Chapter 13 Solutions
Life: The Science of Biology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?arrow_forwardApproximately how many high-energy bonds does DNA polymerase use to replicate a bacterial chromosome (ignoring helicase and other enzymes associated with the replication fork)? compared with its own dry weight of 10–12 g, how much glucose does a single bacterium need to provide enough energy to copy its DNA once?arrow_forwardRichard Boyce and Paul Howard-Flanders conducted an experimentthat provided biochemical evidence that thymine dimers areremoved from DNA by a DNA repair system. In their studies, bacterialDNA was radiolabeled so the amount of radioactivity reflectedthe amount of thymine dimers. The DNA was thensubjected to UV light, causing the formation of thymine dimers. When radioactivity was found in the soluble fraction, thymine dimershad been excised from the DNA by a DNA repair system.But when the radioactivity was in the insoluble fraction, the thyminedimers had been retained within the DNA. The following tableillustrates some of the experimental results involving a normalstrain of E. coli and a mutant strain that was very sensitive to killingby UV light: Explain the results found in this table. Why is the mutant strainsensitive to UV light?arrow_forward
- Assuming DNA replicates semi-conservatively, which of these most closely approximates what you would see after one generation if you were to perform the Meselson-Stahl experiment? one band two bands three bandsarrow_forwardA temperature-sensitive mutation is one in which the defect is not presented functionally until the temperature is raised. In the case described below, the enzymes function normally in bacteria at 37 °C, but are non-functional at 40 °C. Predict the detailed molecular consequences of a loss of function in a temperature-sensitive mutant for each of the following enzymes: a) DNA gyrase, b) DNA polymerase III, c) DNA ligase, d) DNA polymerase I.arrow_forwardThe Meselson-Stahl experiment provided strong evidence that DNA replication was conservative, by alternately growing bacteria in medium with heavy 15N and light 14N. If DNA replication were dispersive, what result would Meselson and Stahl have observed after the first round of DNA replication in light nitrogen? Group of answer choices Two bands, one at the location for pure 15N and one at the location for pure 14N. One band, located half way between the locations for pure 15N and pure 14N. Two bands, one at the location for pure 15N and one located halfway between the locations for pure 15N and pure 14N. None of these Three bands, one at the location for pure 15N, one at the location for pure 14N, and one at a location halfway between.arrow_forward
- A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.arrow_forwardThe 3′ → 5′ exonuclease activity of Pol I excises only unpaired 3′-terminal nucleotides from DNA, whereas this enzyme’s pyrophosphorolysis activity removes only properly paired 3′-terminal nucleotides. Discuss the mechanistic signifi cance of this phenomenon in terms of the polymerase reaction.arrow_forwardYou decide to repeat the Meselson-Stahl experiment, except this time you plan to grow the E. coli cells on light 14N medium for many generations and then transfer them to heavy 15N medium and allow them to grow for 2 additional generations (2 rounds of DNA replication). If the conservative model of DNA replication was correct, what is the expected distribution of DNA in the density gradient after two rounds of replication?arrow_forward
- In a bacterial culture in which all cells are unable to synthesizeleucine (leu-), a potent mutagen is added, and the cells areallowed to undergo one round of replication. At that point, samplesare taken, a series of dilutions are made, and the cells areplated on either minimal medium or minimal medium containingleucine. The first culture condition (minimal medium) allowsthe growth of only leu+ cells, while the second culture condition(minimal medium with leucine added) allows growth of all cells.The results of the experiment are as follows: Culture Condition Dilution ColoniesMinimal medium 10-1 18Minimal medium + leucine 10-7 6What is the rate of mutation at the locus associated with leucinebiosynthesis?arrow_forwardBelow is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…arrow_forwardIn bacterial cells, nucleotide excision repair involves which of the following proteins? DNA glycosylase AP endonuclease photolyase AlkB UvrABC proteins If Meselson and Stahl had results from density gradient analysis of bacterial DNA that indicated only two bands, one of the original density and one that was the same as unlabeled DNA, and no intermediate density band, this would indicate that DNA replication is: constructive semiconservative conservative consecutive cannot determine from the information given 6.In E. coli, which DNA polymerase is primarily responsible for filling in the gaps in the DNA generated during nucleotide excision repair? DNA polymerase I DNA polymerase II DNA polymerase IV DNA polymerase V none of the abovearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License