Life: The Science of Biology
11th Edition
ISBN: 9781319010164
Author: David E. Sadava, David M. Hillis, H. Craig Heller, Sally D. Hacker
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 13.2, Problem 3R
Summary Introduction
To review: The interaction between proteins and DNA.
Introduction:
DNA stands for deoxyribonucleic acid and it is known as the genetic material for all the organisms. Proteins play a crucial role in regulating the central dogma, mainly the transcription process of DNA to RNA. It is involved in replication, repair, and packaging process. The proteins and DNA interact during this process and some of them occur in the major groove where the bases are exposed and some occur in the minor groove, which comprises carbohydrate sections of DNA. The structure of the DNA with major and minor grooves are shown below:
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Within a protein, certain amino acids are positively charged (e.g.,lysine and arginine), some are negatively charged (e.g., glutamateand aspartate), some are polar but uncharged, and some are nonpolar.If you knew that a DNA-binding protein was recognizingthe DNA backbone rather than a base sequence, which aminoacids in the protein would be good candidates for interacting withthe DNA?
The underlying structure of DNA is very simple, consisting of only four possible building blocks. a. How is it possible for DNA to carry complex genetic information if its structure is so simple?
When DNA is heated, it denatures; that is, the strands separate because hydrogen bonds are broken and some base-stacking and hydrophobic interactions are disrupted. The higher the temperature, the larger the number of hydrogen bonds that are broken. After reviewing DNA base pair structure, determine which of the following molecules will denature first as the temperature is raised. Explain your reasoning. a. 5′-GCATTTCGGCGCGTTA-3′ 3′-CGTAAAGCCGCGCAAT-5′ b. 5′-ATTGCGCTTATATGCT-3′ 3′-TAACGCGAATATACGA-5′
Chapter 13 Solutions
Life: The Science of Biology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helixarrow_forwardIn a DNA Double helix ,why doesn't an A or T form two hydrogen bonds(out of the three possible) with G or C? Explain in detail.arrow_forwardThe following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles. A. Is this a DNA or an RNA Molecule? B. Where is the 3’ end of this tetranucleotide? C. Given that the DNA strand which served as a template for the synthesis of this tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?arrow_forward
- Z-DNA derives its name from the zig-zag conformation ofphosphate groups. What features of the DNA molecule allowthis distinctive structure to form?arrow_forwardThe underlying structure of DNA is very simple, consisting of only four possible building blocks.a. How is it possible for DNA to carry complexgenetic information if its structure is so simple?b. What are these building blocks? Can each block besubdivided into smaller units, and if so, what arethey? What kinds of chemical bonds link the building blocks?c. How does the underlying structure of RNA differfrom that of DNA?arrow_forwardA duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) isconstructed, will its melting temperature be higher or lower?arrow_forward
- Briefly explain (1) the structure characteristics of DNA, (2) why different DNA molecules (i.e., with different sequences) could adopt the same B-form double helical structure, and (3) how certain proteins could recognize the specific sequences with the common B-form DNA.arrow_forwardDraw the structure of deoxyribose and number the carbon atoms.Describe the numbering of the carbon atoms in deoxyribose withregard to the directionality of a DNA strand. In a DNA doublehelix, what does the term antiparallel mean?arrow_forwardAs we have focused on DNA, the molecule that stores genetic information in all living things. In particular, we discussed its structure and delved into how we analyze this molecule. Based on your knowledge of these topics,answer several fundamental questions: Question: How do we know that the structure of DNA is in the form ofa right-handed double-helical molecule?arrow_forward
- As we have focused on DNA, the molecule that stores genetic information in all living things. In particular, we discussed its structure and delved into how we analyze this molecule. Based on your knowledge of these topics,answer several fundamental questions: Question: How do we know that in DNA G pairs with C and that Apairs with T as complementary strands are formed?arrow_forwardDNA solution is viscous because of the nature of chemical substance that can intercalate into the DNA helix. An example of such substance is acridine orange. experiments revealed that acridine orange causes an increase in the viscosity of DNA solution.how would you account for this effect?arrow_forwardZ-DNA derives its name from the zig-zag conformation of phosphate groups. What features of the DNA molecule allow this structure to form?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license