ETEXT CAMPBELL BIOLOGY IN FOCUS INSTANT
3rd Edition
ISBN: 9780135964422
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 13.4, Problem 1CC
Summary Introduction
To identify:
The sequence and the types of the bonds that are being cleaved in the sequence of the DNA by the restriction enzyme PvuI namely:
Concept introduction:
The enzyme PvuI cuts in between the T-C
The types of the bonds that will be cleaved in between the nucleotides are the phosphate bonds between the pentose sugar and the nucleotide connecting the next nucleotide in the sequence.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
MAKE CONNECTIONS The restriction site for an enzymecalled PvuI is the following sequence:5’-CGATCG-3’3’-GCTAGC-5’
3
The restriction endonuclease Pstl cuts DNA symmetrically on both strands at the
СТGCAG
sequence:
GACGTC
On the resulting DNA fragments are left 3' overhanging ends of 4 nucleotides. PstI cleaves
the phosphodiester backbone with a-type specificity. In short-hand notation, showing the
identity of phosphates on the ends, draw the two fragments that result from PstI digestion of
the following double-stranded oligonucleotide:
5'-рAATTGCTAСTGCAGAACCGG-3'
3'-ТТAАCGATGACGTCTTGGСС--5'
Sensors detect the flash of
light.
DNA polymerase
Unused
deoxyribonucleotides are
cleaved by apyrase.
ATP is consumed by
luciferase and light is
emitted.
AMP and PP, are
converted into ATP by
sulfurylase.
Template strand
Growing strand
3' TAGGCCTACACTTACGCGAATGT 5'
5' ATCCGGAT 3'
dGTP
dNTPs
dNDPs
dNMPs
+ P₁
PP₁
ATP
[1]
Chapter 13 Solutions
ETEXT CAMPBELL BIOLOGY IN FOCUS INSTANT
Ch. 13.1 - Given a polynucleotide sequence such as GAATTC,...Ch. 13.1 - Prob. 2CCCh. 13.2 - What role does base pairing play in the...Ch. 13.2 - Make a table listing the functions of seven...Ch. 13.2 - MAKE CONNECTIONS What is the relationship between...Ch. 13.3 - Describe the structure of a nucleosome, the basic...Ch. 13.3 - What two properties, one structural and one...Ch. 13.4 - Prob. 1CCCh. 13.4 - DRAW IT One strand of a DNA molecule has the...Ch. 13.4 - Describe the role of complementary base pairing...
Ch. 13 - In his work with pneumonia-causing bacteria and...Ch. 13 - Prob. 2TYUCh. 13 - In analyzing the number of different bases in a...Ch. 13 - The elongation of the leading strand during DNA...Ch. 13 - Prob. 5TYUCh. 13 - Prob. 6TYUCh. 13 - Prob. 7TYUCh. 13 - Prob. 8TYUCh. 13 - Prob. 9TYUCh. 13 - MAKE CONNECTIONS Although the proteins that cause...Ch. 13 - Prob. 11TYUCh. 13 - FOCUS ON EVOLUTION Some bacteria may be able to...Ch. 13 - FOCUS ON ORGANIZATION The continuity of life is...Ch. 13 - Prob. 14TYU
Knowledge Booster
Similar questions
- Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X Garrow_forwardTRANSCRIPTION ein The DNA provided for your animal is one side of the double helix. DNA - MRNA 1. Transcribe the DNA strand into mRNA. Don't forget the special base pair ham AU rules for RNA! VERSION 2 TA Fuentes- 2. Translate the mRNA into an amino acid chain. Notice that this is broken into 1 i nucleotide sequences called CODONS. Use the codon chart to find the i correct amino acids. Remember, translation for each chain always starts with the amino acid methionine (Met) and ends with one of the stop codons (UGA, UAG, UAA). C G G C ity you Co deter y Fuentes- code DNA TAC TGG GGT GT C стс TAG CTA ATC TAC IG G AC G cCc ACC GGT ATG ΑΤΤ thousar ytakes And se MRNA d or create AA Turn in 1l tables DNA TAC CAT TAC C GT CCC TC G GT T AT C TAC AAC AGG CCT TT G GC T CCG ACT MRNA thesis nments AA to Sean Che comme DNA TAC TTG GT T CT C CT G тст ACA ACT TAC CAT CGA TTG GGG T G T TAG ATC S comm MRNA AA Decide if you want to illustrate a horse, coyote, or a cat - get the phenotype information from…arrow_forwardEukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?arrow_forward
- DNA 5' ATGGCTTCTCAATACTGCTTTGTTTTGGTT 3' template strand 3' TACCGAAGAGTTATGACGAAACAAAACCAA 5' coding strand Write down the sequence of nucleotides in a fragment of an m-RNA molecule that will be produced based on the information in the DNA fragment above (start with 5' and end with 3'). If you separate codons in MRNA with blank spaces, it will be easier to do the next step. MRNA: 5' Using a three-letter code for amino acids write the sequence of the first ten amino acids of the protein pectate lyase (refer to the table of 64 codons from a lecture or a textbook).arrow_forwardpcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:arrow_forwardvvnicn the following statements are correct about the repair of a DNA duplex containing the sequence below that is grown INE coli (select all that apply)? Strand A Strand B GATCTAGCCGGCATCCGAT CTAGATCGGACGTAGGCTA Methyl ✔A. MutH cleaves Strand A O B. DNA repair will result in the bold A in strand B being replaced with a C O C. DNA repair will result in the bold G in strand A being replaced with a T ✔ D. Defect will not be properly repaired in dam(-) E coli O E. The mammalian repair system would also correct the mismatch shown based on the methylation status of the DNAarrow_forward
- Telomerase supplies its own template RNA molecule as shown in Figure 3 below: B AAUCCCAAU TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the ends (5' and 3') on the DNA and RNA strand at position X, Y and Z, in the Figure 3. (ii) Draw and explain the two loop structures at the end of telomere.arrow_forwardRemember when looking up a codon make sure it is in its mRNA form. Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 2.What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this? Often this type of mutation does show symptoms until middle age. What problem does this create? 3.What are three differences between a point mutation and deletion mutationarrow_forwardCoding DNA 5’- GTG ACT CGT TGT GCC ATT GCA GCT AAA CAC TTC GAG CCC TGT- 3’ mRNA 5’- GUG ACU CGU UGU GCC AUU GCA GCU AAA CAC UUC GAG CCC UGU- 3’ What is the polypeptide sequence?arrow_forward
- Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'arrow_forwardTemplate strand: 5' AATCATAACTCATTG 3' A. Write the CODING strand of this sequence, including the 5' and 3' end designations. B. Write the amino acid sequence coded by this mRNA. The start codon is the first codon in the sequence that codes for Met. First position (5'-end) U < G บบบ UUC phe UUA UUG CUU Couleu CUC Coc CUA CUG AUU AUG AUC ile GUU GUC GUA GUG Second position C UCU UCC UCA UCG val CCU co CCC CCA 000 CCG ACU ACC ACC AUA ACA thr AUA ACA AUG met ACG GCU GCC ser GCA GCG pro ala UAU ORD tyr UAC UAA Stop UAG Stop CAU CAC CAA CAG - AAU AAC www AAA 10 asn AAG 7 his GAU GAC GAA GAG gin }| lys asp glu UGU UGC cys UGA Stop UGG trp CGU C00 CGC CGA 000 CGG AGU AGC ACA AGA AGG GGU GGC GGA GGG Initiation Termination arg ser arg gly DUAL SUAU DUAU DUAG Third position (3-end)arrow_forward5' cap 5'UTR Coding sequence 3' UTR Poly-A tail AUG A C UGA Exon 1 Exon 2 Exon 3 Exon 4 AAAAAAAAAAAAAAAAAAAAAAA 3' D E T C A F E D B B Farrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning