Campbell Biology in Focus (2nd Edition)
2nd Edition
ISBN: 9780321962751
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13.4, Problem 2CC
DRAW IT One strand of a DNA molecule has the following sequence: 5’-CCTIGACGATCGTIACCG-3’. Draw the other strand. Will Pvul (see question 1) cut this molecule? If so, draw the products
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
DRAW IT One strand of a DNA molecule has the following sequence:5’-CTTGACGATCGTTACCG-3’Draw the other strand. Will PvuI (see question 1) cut thismolecule? If so, draw the products
The DNA nucleotide sequence that's complementary will base pair to a strand of DNA with the following sequence, 5' GTAATC 3' is?
5'GUAAUC3'
3'CATTAG5'
5'CATTAG3'
3'CAUUAG5'
3'GTAATC5'
A portion of one strand of DNA has the sequence 5′ AATGGCTTA 3′. If this strand is used as a template for DNA replication, write the sequence of the newly synthesized strand in the direction from left to right in which it will be synthesized.
Chapter 13 Solutions
Campbell Biology in Focus (2nd Edition)
Ch. 13.1 - Given a polynucleotide sequence such as GAATTC,...Ch. 13.1 - Prob. 2CCCh. 13.2 - What role does base pairing play in the...Ch. 13.2 - Make a table listing the functions of seven...Ch. 13.2 - MAKE CONNECTIONS What is the relationship between...Ch. 13.3 - Describe the structure of a nucleosome, the basic...Ch. 13.3 - What two properties, one structural and one...Ch. 13.4 - Prob. 1CCCh. 13.4 - DRAW IT One strand of a DNA molecule has the...Ch. 13.4 - Describe the role of complementary base pairing...
Ch. 13 - In his work with pneumonia-causing bacteria and...Ch. 13 - What is the basis for the difference in how the...Ch. 13 - In analyzing the number of different bases in a...Ch. 13 - The elongation of the leading strand during DNA...Ch. 13 - Prob. 5TYUCh. 13 - Prob. 6TYUCh. 13 - Prob. 7TYUCh. 13 - Prob. 8TYUCh. 13 - Prob. 9TYUCh. 13 - MAKE CONNECTIONS Although the proteins that cause...Ch. 13 - Prob. 12TYUCh. 13 - FOCUS ON EVOLUTION Some bacteria may be able to...Ch. 13 - FOCUS ON ORGANIZATION The continuity of life is...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Energy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from_______. a. ATP b. DNA polymerase c. the nucleotide d. a and carrow_forwardEnergy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from ______. a. phosphate-group transfers from ATP b. DNA polymerase c. the nucleotide itself d. a and carrow_forwardIn a sample solution given to be analyzed;CATAGCTTTGTTAAA (DNA nucleotide chain). Show the 5 'and 3' ends by writing in triplet (codon) form. Find the number of Hydrogen bonds in the double helix DNA strand at the beginning.arrow_forward
- One strand of DNA has the base sequence as shown below. Complete the transcription and translation of this strand. Non template strand: 5' A T G T A T G C C A A T G C A 3’ What is the amino acids?arrow_forwardIf the sequence of one strand of DNA is written as follows:5' -ATGCATGCATGCATGCATGCATGCATGC-3'Write down the sequence of complementary strand in 5'→3' directionarrow_forwardLike DNA, RNA follows base-pairing rules. Experiment to find which RNA nucleotide on the right side of the Gizmo will successfully pair with the thymine at the top of the template strand of DNA. (NOTE: The DNA on the right side is the template strand.) Which RNA base bonded with the thymine?arrow_forward
- DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, whats the non-template/sense/coding strand from the STARND DNA? also what's the arrangement of m-RNA and the chain arrangement of the amino acids that will be made according to the order of the RNA?PLS DONT ANSWER THE DEFINITION ONLY, READ THE QUESTION CAREFULLYarrow_forward4. Which is NOT a difference between RNA and DNA? Select one: A. RNA contains uracil; DNA usually does not. B. RNA is usually single-stranded; DNA is double-stranded. C. The sugar ring of RNA is more oxidized than that in DNA. D. RNA cannot form helices.arrow_forwardATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of nucleotides. 1. Write the complementary DNA strand to the above sample. 2. Write the RNA complementary strand to the original DNA strand.arrow_forward
- One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment?arrow_forwardA DNA strand has the following sequence: 5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′In which direction would DNA polymerase slide along this strand(from left to right or from right to left)? If this strand was used as atemplate by DNA polymerase, what would be the sequence of thenewly made strand? Indicate the 5′ and 3′ ends of the newly madestrand.arrow_forwardPolymerases work is to add 10 nucleotides to a DNA strand before dissociating. During replication process, DNA pol III can add tens of thousands of nucleotides at a moving fork. How this additionaccomplished?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY