(a)
To draw:
The new synthesized DNA strand with (a) color coding of the parental DNA strand, single stranded binding protein, sliding clamp, and DNA polymerase-III enzyme (b) labeling of the parental DNA strand, single stranded binding protein, sliding clamp, and DNA-polymerase-III enzyme in the given diagram.
Introduction:
The DNA synthesis machinery consists of the parental DNA strand, single stranded binding proteins, sliding clamp, DNA polymerase-III and the sliding clamp.
To draw:
The diagram of newly synthesized DNA with the parental DNA strand, single stranded binding protein, sliding clamp and DNA polymerase-III enzyme.
(b)
To label:
The diagram of the newly synthesized DNA with the parental DNA strand, single stranded binding protein, sliding clamp and DNA polymerase-III enzyme with the direction of replication.
Want to see the full answer?
Check out a sample textbook solutionChapter 13 Solutions
Campbell Biology in Focus (2nd Edition)
- Watch this video (http://openstaxcollege.org/l/DNArep) to learn about DNA replication. DNA replication proceeds simultaneously at several sites on the same molecule. What separates the base pair at the start of DNA replication?arrow_forwardHow does DNA replication occur in a precise manner to ensure that identical genetic information is put into the new chromatid? See Figures 8.12 and 8.13. FIGURE 8.12 In DNA replication, the two polynucleotide strands uncoil, and each is a template for synthesizing a new strand. A replicated DNA molecule contains one new strand and one old strand. This mechanism is called semiconservative replication. FIGURE 8.13 A close-up look at the process of DNA replication. (a) As the strands uncoil, bases are added to the newly synthesized strand by complementary base pairing with bases in the template strand. The new bases are linked together by DNA polymerase. (b) DNA synthesis can proceed only in the 5 3 direction; newly synthesized DNA on one template strand is made in short segments and linked together by the enzyme DNA ligase.arrow_forwardEVOLUTION LINK DNA technology, such as the production of transgenic animals, is possible only because widely different organisms have essentially identical genetic systems (DNA RNA protein). What is the evolutionary significance of the universality of genetic systems in organisms as diverse as bacteria and pigs?arrow_forward
- Which technique rapidly replicated specific DNA fragments without cloning in cells? (a) gel electrophoresis (b) cDNA libraries (c) DNA probe (d) restriction fragment length polymorphism (e) polymerase chain reactionarrow_forwardReview Figures 8.12 and 8.13. In cells, the primers for DNA synthesis are short strands of RNA, so each newly-synthesized strand of DNA has a segment of RNA al its 5 end. As replication proceeds, DNA polymerases remove these RNA segments and fill in the resulting gaps with DNA. However, the gaps at the very 5 ends of the new strands cannot be filled in with DNA. Why not? DNA replication leaves exposed about 100 nucleotides al the 5 end of each template strand, and these single-stranded ends are removed. What are the effects of this "end problem" on a cell's DNA as it continues to divide? FIGURE 8.12 DNA replication. Green arrows show the direction of synthesis for each strand. The Y-shaped structure where the DNA molecule is being unwound is called a replication fork. FIGURE 8.13 Discontinuous synthesis of DNA. This close-up of a replication fork shows that only one of the two new DNA strands is assembled continuously. The other is assembled in short segments.arrow_forwardCancer is a disease caused by cells that divide uncontrollably. Scientists studying drugs that prevent cancer often measure the effectiveness of a drug by its effect on DNA replication. During normal DNA replication, nucleotides are added at a rate of about 50 nucleotides per second in mammals and 500 nucleotides per second in bacteria. 3. Predicting Outcomes. How would the total time needed to add 4,000 nucleotides be affected if a drug that inhibits DNA polymerase were present? Explain your answer.arrow_forward
- Draw a replication bubble. Be sure to label the directionality of all strands of DNA. For one of the two replication forks, draw and label all of the proteins required the text describes as being important for DNA synthesis, and label the leading and lagging strands.arrow_forwardIllustrate some steps involved in DNA replication :Suppose the following base sequence was found in a segment of one strand of a DNA molecule: 3’ A-A-T-A-C-C-T-C-C-T-A-A-C-T 5’ What would be the bases in the complementary strand? Label the 3’ and the 5’ ends. Illustrate the DNA molecule below. Label the 3’ and the 5’ ends of both strands. Separate the above DNA molecule up to the seventh base. Add one primer for the leading strand complementary to the first base Adenine of the template strand. Add one primer for the lagging strand complementary to the seventh base Adenine of the template strand. Illustrate the DNA molecule. Label the 3’ and 5’ ends. Elongate the new strands up the seventh base by adding DNA bases complementary to the template strand. Illustrate the resulting DNA molecule. Label the 3’ and the 5’ ends of the template strands and the complementary strands. Elongate the new strands up the seventh base by adding DNA bases complementary to the template strand. Illustrate…arrow_forwardThe numbered events listed below participate in the generation of junctional diversity. Put them in chronological order. a. DNA strands pair, and unpaired nucleotides are removed by exonuclease activity. b. P-nucleotides are generated after nicking of one DNA strand. c. DNA polymerase fills in gaps, and DNA ligation forms a coding joint. d. The RAG complex cleaves heptamer RSSs, and DNA hairpins are formed. e. Terminal deoxynucleotidyl transferase adds N-nucleotides to the 3ʹ end of the stretch of P-nucleotides.arrow_forward
- Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)arrow_forwarda) Estimate the lengths of each of the DNA fragments shown in this gel A:____________ B: ____________ C: ____________ D: ____________ E: ____________ F: ____________ b) Which letter represents the DNA fragment that is the smallest? c) Which DNA fragment is approximately the same length as the lengths of fragments D & C added together? Part 4. Putting It Together 1) Consider the diagram below as well as the given information. This diagram represents a piece of circular DNA which was cut in 4 separate reactions (4 different test tubes, each with some of this DNA in it). One digest was done with AvaI, another with ClaI, a third with EcoRV, and a fourth with ScaI. The locations of the recognition sequences for each restriction enzyme are shown along with the location of that site in bp along the circle (it goes clockwise from position 1). You run an agarose gel with a molecular weight marker in the first lane, the AvaI digest in lane 2, the ClaI digest in lane 3, the…arrow_forwardPolymerases work is to add 10 nucleotides to a DNA strand before dissociating. During replication process, DNA pol III can add tens of thousands of nucleotides at a moving fork. How this additionaccomplished?arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College