ESSENTIALS OF GENETICS-MODIFIED ACCESS
9th Edition
ISBN: 9780134190006
Author: KLUG
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 22PDQ
Many eukaryotic promoter regions contain CAAT boxes with consensus sequences CAAT or CCAAT approximately 70 to 80 bases upstream from the transcription start site. How might one determine the influence of CAAT boxes on the transcription rate of a given gene?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Many eukaryotic promoter regions contain CAAT boxes with consensus sequences CAAT or CCAAT approximately 70 to 80 bases upstream from the transcription start site. How might one determine the influence of CAAT boxes on the transcription rate of a given gene?
Many promoter regions contain CAAT boxes containing consensus sequences CAAT or CCAAT approximately 70 to 80 bases upstream from the transcription start site. How might one determine the influence of CAAT boxes on the transcription rate of a given gene?
For each of the following transcription factors, explain how eukaryotic transcriptional initiation would be affected if it were missing.
A. TFIIB C. TFIIH
B. TFIID
Chapter 15 Solutions
ESSENTIALS OF GENETICS-MODIFIED ACCESS
Ch. 15 -
CASE STUDY | A mysterious muscular dystrophy
A...Ch. 15 -
CASE STUDY |A mysterious muscular dystrophy
A...Ch. 15 -
CASE STUDY |A mysterious muscular dystrophy
A...Ch. 15 -
HOW DO WE KNOW?
1. In this chapter, we have...Ch. 15 -
2. Review the Chapter Concepts list on p. 280....Ch. 15 - Describe which enzymes are required for lactose...Ch. 15 - Contrast positive versus negative regulation of...Ch. 15 -
5. Both attenuation and riboswitches rely on...Ch. 15 - For the lac genotypes shown in the accompanying...Ch. 15 -
7. For the genotypes and conditions (lactose...
Ch. 15 -
8. The locations of numerous lacI– and lacIs...Ch. 15 - Explain why catabolite repression is used in...Ch. 15 - Describe experiments that would confirm whether or...Ch. 15 - Predict the level of genetic activity of the lac...Ch. 15 - Predict the effect on the inducibility of the lac...Ch. 15 -
13. Describe the role of attenuation in the...Ch. 15 -
14. In a theoretical operon, genes A, B, C, and D...Ch. 15 - A bacterial operon is responsible for production...Ch. 15 - A marine bacterium is isolated and is shown to...Ch. 15 -
17. Why is gene regulation more complex in a...Ch. 15 -
18. List and define the levels of eukaryotic gene...Ch. 15 -
19. Distinguish between the cis-acting regulatory...Ch. 15 - Prob. 20PDQCh. 15 - Compare the control of gene regulation in...Ch. 15 - Many eukaryotic promoter regions contain CAAT...Ch. 15 -
23. What is RNA-induced gene silencing in...Ch. 15 - Although it is customary to consider...Ch. 15 - DNA methylation is commonly associated with a...Ch. 15 - The interphase nucleus appears to be a highly...Ch. 15 - It has been estimated that at least two-thirds of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Transcriptional regulators are proteins that bind to promoters (the 5-flanking regions of genes) to regulate their transcription. Assume that a particular transcription regulator normally promotes transcription of gene X, a transport protein. If a mutation makes this regulator gene nonfunctional, would the resulting phenotype be similar to a mutation in gene X itself? Why or why not?arrow_forwardIn eukaryotes many transcriptional activators are dimers of related proteins. Assuming each dimer binds to one unique sequence, how many unique sequences can protein dimers derived from a family of six related proteins bind to?arrow_forwardThe following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Is this terminator rho independent or rho dependent?arrow_forward
- The nucleus of a eukaryotic cell is much larger than a bacterium, and it contains much more DNA. As a consequence, a transcription regulator in a eukaryotic cell must be able to select its specific binding site from amongmany more unrelated sequences than does a transcription regulator in a bacterium. Does this present any special problems for eukaryotic gene regulation?arrow_forwardSeveral examples of antisense RNA regulating translation in bacterial cells have been discovered. Molecular geneticists have also used antisense RNA to artificially control transcription in both bacterial and eukaryotic genes. If you wanted to inhibit the transcription of a bacterial gene with antisense RNA, what sequences might the antisense RNA contain?arrow_forwardSuppose that the string of A nucleotide following the inverted repeat in a rho-independent terminator were deleted, but the the inverted was left intact. How will this deletion affect transcription termination?arrow_forward
- Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination. Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds.arrow_forwardThe APETALA1:GUS line you were given is a transcriptional fusion. Given that APETALA1 encodes a transcription factor, where might you expect to detect the expression of a translational reporter gene fusion?arrow_forwardMutations in bacterial promoters may increase or decrease the rate of gene transcription. Promoter mutations that increase the transcription rate are termed up-promoter mutations, and those that decrease the transcription rate are termed down-promoter mutations. As shown , the sequence of the −10 site of the promoter for the lac operon is TATGTT. Would you expect the following mutations to be up-promoter or down-promoter mutations? A. TATGTT to TATATT B. TATGTT to TTTGTT C. TATGTT to TATGATarrow_forward
- The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.arrow_forwardShown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?arrow_forwardThe mechanism for RNA-induced transcriptional silencing of heterochromatic DNA is paradoxical. For example, how does it make sense that centromeric DNA in fission yeast first needs to be transcribed before it can be transcriptionally silenced?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license