EBK CONCEPTS OF GENETICS
12th Edition
ISBN: 9780134818979
Author: Killian
Publisher: YUZU
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 2PDQ
CONCEPT QUESTION Review the Chapter Concepts list on page 340. These concepts relate to how gene mutations occur, their
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A hypothetical gene for cephalosporin resistance is found to be carried by a transposon. Explain what a transposon is. Then explain how the cephalosporin resistance could be horizontally transferred between organisms by transformation, conjugation, and transduction. What steps/events would have to occur to allow the transposon to be transferred by each method. Also, explain how it could be transferred vertically between organisms.
Describe in detail three spontaneous lesions that can lead to mutations. Give examples.
The design of antibiotics requires that the drug prevents the growth of bacteria without compromising cellular functions in humans. I’d like you to think of the differences in the process of gene expression in prokaryote and eukaryotes and suggest two possible targets for the design of an antibiotic. Explain what processes you are preventing (you can include replication if you’re familiar with this process) and how your drug would be targeted to affect prokaryotes only.
Chapter 15 Solutions
EBK CONCEPTS OF GENETICS
Ch. 15 - If a point mutation occurs within a human egg cell...Ch. 15 - One of the most famous cases of an X-linked...Ch. 15 - The cancer drug melphalan is an alkylating agent...Ch. 15 - Geneticists often use the alkylating agent...Ch. 15 - Six months pregnant, an expectant mother had a...Ch. 15 - Six months pregnant, an expectant mother had a...Ch. 15 - HOW DO WE KNOW? In this chapter, we focused on how...Ch. 15 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 15 - What is a spontaneous mutation, and why are...Ch. 15 - Prob. 4PDQ
Ch. 15 - Prob. 5PDQCh. 15 - Why is a random mutation more likely to be...Ch. 15 - Most mutations in a diploid organism are...Ch. 15 - What is the difference between a silent mutation...Ch. 15 - Describe a tautomeric shift and how it may lead to...Ch. 15 - Contrast and compare the mutagenic effects of...Ch. 15 - Why are frameshift mutations likely to be more...Ch. 15 - Why are X rays more potent mutagens than UV...Ch. 15 - DNA damage brought on by a variety of natural and...Ch. 15 - Contrast the various types of DNA repair...Ch. 15 - Mammography is an accurate screening technique for...Ch. 15 - A significant number of mutations in the HBB gene...Ch. 15 - Describe how the Ames test screens for potential...Ch. 15 - Prob. 18PDQCh. 15 - Compare DNA transposons and retrotransposons. What...Ch. 15 - Prob. 20PDQCh. 15 - In maize, a Ds or Ac transposon can alter the...Ch. 15 - Prob. 22PDQCh. 15 - In a bacterial culture in which all cells are...Ch. 15 - Presented here are hypothetical findings from...Ch. 15 - Prob. 25ESPCh. 15 - Prob. 26ESPCh. 15 - What evidence indicates that mutations in human...Ch. 15 - Among Betazoids in the world of Star Trek, the...Ch. 15 - Skin cancer carries a lifetime risk nearly equal...Ch. 15 - It has been noted that most transposons in humans...Ch. 15 - Mutations in the IL2RG gene cause approximately 30...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Two types of mutations discussed in this chapter are (1) nucleotide changes and (2) unstable genome regions that undergo dynamic changes. Describe each type of mutation.arrow_forwardAnswer completely and correctly: Why is it more likely that insertions or deletions will be more detrimental to a cell than point mutations?arrow_forwardName three ways in which genetic information of bacteria can be changed.arrow_forward
- Describe how you would use replica plating of mutagenized, haploid yeast cells to identify temperature-sensitive (ts) mutations in essential genes needed for yeast growth and survival.arrow_forwardSeveral common antibiotics affect some strains of bacteria's ability to carry out transcription and/or translation. For example: Rifamycin inhibits prokaryotic RNA polymerase Chloramphenicol blocks the transfer of the peptide from the P to A site. a) For each of these drugs, identify at what point it could affect the process of DNA->RNA->protein. Be as specific as possible. b) Why do you think these drugs kill bacteria but spare animal cells? (Hint: remember bacteria are prokaryotes)arrow_forwardSome mutations affect changes in protein structure and function that can result in disease whereas other mutations have no significant effects on protein structure and function. Please explain reasons for the above mentioned statement. Human civilization has resulted in a large number of potentially mutagenic chemicals (e.g. pesticides) and has changed the environment to increase the likelihood of encountering other mutagens, especially UV radiation. What roles should the authorities play in identifying mutagens and regulating their release into the environment?arrow_forward
- The following is a list of mutational changes. For each of the specific mutations described, indicate which of the following terms could apply, either as a description of the mutation or as a possible cause. More than one term from the right column can apply to each statement in the left column. 1. an A-T base pair in the wild-type gene is changed to a G-C pair 2. an A-T base pair is changed to a T-A pair a. transition b. base substitution c. transversion 3. the sequence AAGCTTATCG is changed to d. inversion AAGCTATCG c. translocation f. deletion 4. the sequence AAGCTTATCG is changed to AAGCTTTATCG g. insertion 5. the sequence AACGTTATCG is changed to AATGTTATCG h. decamination 6. the sequence AACGTCACACACACATCG is i. X-ray irradiation changed to AACGTCACATCG j. intercalator 7. the gene map in a given chromosome arm is changed from bog-rad-fox1-fox2-try-duf (where foxl and fox2 are highly homologous, recently diverged genes) to bog-rad-fox1-fox3- fox2-try-duf (where fox3 is a new gene…arrow_forwardAn investigator was interested in studying UAG nonsense suppressor mutations in bacteria. In one speciesof bacteria, she was able to select two different mutants of this type, one in a tRNATyr gene and the otherin a tRNAGln gene, but in a second species, she wasnot able to obtain any such nonsense suppressor mutations, even after very extensive effort. What couldexplain the difference between the two species?arrow_forwardThe following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairingarrow_forward
- For the given mutation below,please write down the reverse mutation and any intragenic suppressor mutations for that mutation. Use the codon table for amino acids as reference. In this case, mutation means single letter change. Mutation: AGA -> AGC Arg codons: CGU, CGC, CGA, CGG,AGA,ACG Ser codons: UCU, UCC, UCA, UCG, AGU, AGC Character limit is 10 characters. Write down Reverse mutation sequence first and then intragenic suppressor mutation sequence. Write down the mutated sequence not the mutation.arrow_forwardDescribe the medical applications of human gene therapy in the following diseases: Haemophilia, Cystic fibrosis, and Leber congenital amaurosis.arrow_forwardIn the replica plate experiment, it shows that mutations are random. However, certain environmental stresses (such as high temperature, high salt, and low pH) can increase the mutation rate. QUESTIONS: Does this indicate that mutations are nonrandom, since they increase in response to cell stressors?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY