Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 3P
Reverse translation is a term given to the process of deducting the DNA sequence that could encode a particular protein. If you had the amino acid sequence Trp His Ile Met:
| a. | What human nuclear DNA sequence could have encoded these amino acids? (Include all possible variations.) |
| b. | What human mitochondrial DNA sequence could have encoded these amino acids? (Include all possible variations.) |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Reverse translation is a term given to the process ofdeducing the DNA sequence that could encode a particular protein. If you had the amino acid sequenceTrp His Ile Met:a. What human nuclear DNA sequence could haveencoded these amino acids? (Include all possiblevariations.)b. What human mitochondrial DNA sequence couldhave encoded these amino acids? (Include allpossible variations.)
Sickle cell anemia is an example of a genetic disease caused by a point mutation. To answer this question look at the information in chapter 3 of the OpenStax book. If you use another resource that is fine but you will need to share the link.
a. Describe the specific change in the nucleotide sequence sequence from normal to mutated hemoglobin.
b. Describe the specific change in the amino acid sequence from normal to mutated hemoglobin.
c. Explain the structural effect that this point mutation has on the hemoglobin protein.
d. Explain how this mutation affects the function of the hemoglobin protein.
Consider the following gene with their respective introns and exons
5’ – TCATGCATTTTGCGCGGGAAATAGCTCA – 3’
3’ – AGTACGTAAAACGCGCCCTTTATCGAGT – 5’
Using the bottom as a template strand, create:
A. A primary mRNA transcript B. A processed mRNA transcriptC. Highlight where your START and STOP codons are in your processed transcript (if there are any). D. The resulting protein sequence
Chapter 15 Solutions
Genetics: From Genes to Genomes
Ch. 15 - Match each numbered item with the most closely...Ch. 15 - Assuming human cells have on average 1000...Ch. 15 - Reverse translation is a term given to the process...Ch. 15 - The human nuclear genome encodes tRNAs with 32...Ch. 15 - The human mitochondrial genome includes no genes...Ch. 15 - How do you know if the halibut you purchased at...Ch. 15 - Is each of these statements true of chloroplast or...Ch. 15 - Suppose you are characterizing the DNA of a...Ch. 15 - An example of a gene-targeting DNA plasmid vector...Ch. 15 - Which of the following characteristics of...
Ch. 15 - The Saccharomyces cerevisiae nuclear gene ARG8...Ch. 15 - The so-called hypervariable regions HV1 and HV2 of...Ch. 15 - Suppose a new mutation arises in a mitochondrial...Ch. 15 - Describe at least two ways in which the...Ch. 15 - Why are severe mitochondrial or chloroplast gene...Ch. 15 - Suppose you are examining a newly found plant...Ch. 15 - A form of male sterility in corn is inherited...Ch. 15 - Plant breeders have long appreciated the...Ch. 15 - A mutant haploid strain of Saccharomyces...Ch. 15 - Prob. 20PCh. 15 - What characteristics in a human pedigree suggest a...Ch. 15 - The first person in the family represented by the...Ch. 15 - In 1988, neurologists in Australia reported the...Ch. 15 - If you were a genetic counselor and had a patient...Ch. 15 - Kearns-Sayre syndrome KSS, Pearson syndrome, and...Ch. 15 - Many clinically relevant mitochondrial diseases...Ch. 15 - Leigh syndrome is characterized by psychomotor...Ch. 15 - All mutations in mitochondrial genes ultimately...Ch. 15 - How could researchers have determined that the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You have sequenced the genome of the bacterium Salmonella typhimurium, and you are using BLAST analysis to identify similarities within the S. typhimurium genome to known proteins. You find a protein that is 100 percent identical in the bacterium Escherichia coli. When you compare nucleotide sequences of the S. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical.a. Explain this observation.b. What do these observations tell you about the merits of nucleotide- versus protein-similarity searches in identifying related genes?arrow_forwardDNA from a eukaryotic gene was isolated, denatured, and hybridized to the mRNA transcribed from the gene; the hybridized structure was then observed with an electron microscope. The adjoining diagram shows the structure that was observed. a. How many introns and exons are there in this gene? Explain your answer.arrow_forwardDNA from a eukaryotic gene was isolated, denatured, and hybridized to the mRNA transcribed from the gene; the hybridized structure was then observed with an electron microscope. The adjoining diagram shows the structure that was observed. a. Identify and label the exons and introns in this hybridized structure.arrow_forward
- In the table below, there are four versions of gene A, one of which is normal, and the other three which contain mutations that make the gene product nonfunctional. Focus on the shaded region of the sequence. Use the genetic code table to answer the question. How would you describe Mutation #2? Partial DNA sequence for gene A ("..." indicates many nucleotides of sequence not shown) 5' ... ATG GTG AGC AAG GAG GAG CTG TTC ACC TGT AAA TAG ... Normal Mutation #1 5' ... ATG GTG AGC AAG GAG AAG CTG TTC ACC TGT AAA TAG ... Mutation #2 5' ... ATG GTG AGC AAG TAG GAG CTG TTC ACC TGT AAA TAG ... Mutation #3 5' ... ATG GTG AGC AAG GAG CTG TTC ACC TGT AAA TAG ... Silent mutation Nonsense mutation Frameshift mutations Missense mútationarrow_forwardThe human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?arrow_forwardA 2500 bp region of the human genome encodes two genes. One of the genes encodes a protein of 600 amino acids and the other gene encodes a protein of 280 amino acids. The mRNA sequences of the two genes do not contain any of the same nucleotide sequences (i.e. they do not overlap). How is this possible? Fully explain your answer.arrow_forward
- Shown below is a portion of a DNA sequence ( 31 base pairs long ) that encodes the last amino acids of a protein : The first three underlined base pairs indicate the frame and include the coding region . 123456789 A. Write the peptide sequence of the last 6 amino acids of the protein . Label both ends of the peptide . B. A insertion of one base pair causes the protein to decrease in length by 5 amino acids . With respect to the sequence given above , where does this insertion occur , and what base pair will you insert ? C. An change of one base pair leads to the protein to increase in length by one amino acid. With respect to the sequence given above , which base pair would you change ? How would you change this base pair for the protein to increase in length by one amino acid ?arrow_forwardBelow is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?arrow_forwardYou would like to add a nuclear localization sequence (NLS) of Lys-Lys-Lys-Arg-Lys to a protein that is usually found in the cytoplasm of a yeast cell. To accomplish this, you introduce the nucleotide sequence encoding the NLS into the gene that encodes the cytoplasmic protein of interest. a. What is the size of the nucleotide insert that will encode the NLS? Briefly explain. 5' 3' b. Below is a diagram of the gene encoding the cytoplasmic protein of interest in the yeast genome. If your goal is to put the NLS at the carboxyl (C) terminus of the protein, at which location (A-E) should the NLS be inserted? Briefly explain. A TATAA ATATT promoter +1 B ATG TAC D TAA ATT stop codon E 3' 5'arrow_forward
- We are given a random DNA sequence (each of the 4 bases has equal probability of occurring at each position in the sequence). A. What is the probability that three adjacent bases (a triplet) encode a stop codon? B. What is the probability that a given triplet is not a stop codon? C. What is the probability that neither of two adjacent triplets is a stop codon? D. What is the probability that none of 100 adjacent triplets are stop codons? E. Consider a single base insertion mutation between the 3rd and 4th codons in a natural gene that encodes a protein 100 amino acids long. Is it more likely that the protein produced by this mutant allele will be shorter or longer than 100 amino acids long?arrow_forwardYou are studying a large eukaryotic gene that is 439,515 base pairs long. You find the polypeptide that this gene produces in liver cells is 46,771 amino acids long. Your colleague studies the function of this gene in brain cells, and finds the polypeptide produced in the brain is much larger – 61,438 amino acids long. How do you explain this difference? Possible Answers: A. The cell cycle of liver cells is much longer than that of brain cells. B. This is due to alternative splicing. in the brain C. There was a different complement of sequence-specific transcription factor binding sites in the CRM of the brain cells. D. There is no 5' cap added to the gene product from the liver cells.arrow_forwardBelow is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License