BIOLOGY
12th Edition
ISBN: 9781260169614
Author: Raven
Publisher: RENT MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 6U
RNA polymerase binds to a ________ to initiate _______.
a. mRNA; translation
b. promoter; transcription
c. primer; transcription
d. transcription factor; translation
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
After transcription, the molecule that is formed is
a.complementary to part of one strand of DNA.
b.complementary to both strands of DNA.
c.double-stranded and inside the nucleus.
d.identical to an entire single strand of DNA.
Transcription is similar to DNA replication because both processes_______ . a. use the same enzyme b. copy both strands c. require the same nucleotides d. proceed in the 5′ to 3′ direction
Addition or deletion of bases causes which kind of mutation?
Select one:
a.
Frameshift mutation
b.
Transversion
c.
Transition
d.
Transcription
Chapter 15 Solutions
BIOLOGY
Ch. 15.1 - Prob. 1LOCh. 15.1 - Prob. 2LOCh. 15.1 - List the roles played by RNA in gene expression.Ch. 15.2 - Prob. 1LOCh. 15.2 - Describe the characteristics of the genetic code.Ch. 15.2 - Prob. 3LOCh. 15.3 - Prob. 1LOCh. 15.3 - Differentiate among initiation, elongation, and...Ch. 15.3 - Prob. 3LOCh. 15.4 - Prob. 1LO
Ch. 15.4 - Prob. 2LOCh. 15.4 - Explain the differences between bacterial and...Ch. 15.5 - Prob. 1LOCh. 15.5 - Prob. 2LOCh. 15.5 - Prob. 3LOCh. 15.6 - Explain why the tRNA charging reaction is critical...Ch. 15.6 - Prob. 2LOCh. 15.7 - Prob. 1LOCh. 15.7 - Prob. 2LOCh. 15.7 - Compare translation on the RER and in the...Ch. 15.9 - Prob. 1LOCh. 15.9 - Explain the nature of triplet repeat expansion.Ch. 15.9 - Prob. 3LOCh. 15 - Prob. 1DACh. 15 - Prob. 2DACh. 15 - Prob. 1IQCh. 15 - Prob. 2IQCh. 15 - Prob. 3IQCh. 15 - The experiments with nutritional mutants in...Ch. 15 - What is the central dogma of molecular biology? a....Ch. 15 - In the genetic code, one codon a. consists of...Ch. 15 - Eukaryotic transcription differs from prokaryotic...Ch. 15 - An anticodon would be found on which of the...Ch. 15 - RNA polymerase binds to a ________ to initiate...Ch. 15 - During translation, the codon in mRNA is actually...Ch. 15 - You have mutants that all affect the same...Ch. 15 - The splicing process a. occurs in prokaryotes. b....Ch. 15 - The enzyme that forms peptide bonds is called...Ch. 15 - In comparing gene expression in prokaryotes and...Ch. 15 - The codon CCA could be mutated to produce a. a...Ch. 15 - An inversion will a. necessarily cause a mutant...Ch. 15 - What is the relationship between mutations and...Ch. 15 - Prob. 1SCh. 15 - Frameshift mutations often result in truncated...Ch. 15 - Describe how each of the following mutations will...Ch. 15 - There are a number of features that are unique 10...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A promoter is ______. a. a specific sequence of DNA nucleotides b. a specific sequence of RNA nucleotides c. a protein that binds to DNA d. an enzyme that synthesizes RNAarrow_forwardEnergy that drives translation is provided mainly by ______ . a. ATP c. GTP b. amino acids d. ribosomesarrow_forwardWhich of the following is an example of a transcription factor? A) gene B) a repressor C) a ribosome D) an intronarrow_forward
- Which statement regarding UTRs is TRUE? a) Transcription begins at the start of the 5' UTR b) Translation begins at the start of the 5' UTR c) The 5' and 3' UTRs are spliced from the mRNA transcript d) The translation stop codon is found downstream of the 3' UTRarrow_forwardIn Eukaryotes, DNA is a long molecule inside a tiny nucleus. a. How can this long chain fit in such space? b. How does it affect gene expression?arrow_forwardWhich of the following best describes mRNA?Group of answer choices a) Complexes with ribosomal proteins to form ribosomes b) Transports amino acids to ribosomes during translation c) Provides the instructions for the amino acid sequence of a polypeptide d) Used for eukaryotic RNA processingarrow_forward
- RNA polymerase binds to a _________ to initiate _________. a. mRNA; translation b. promoter; transcription c. primer; transcription d. transcription factor; translationarrow_forwardTreating a cell with a drug to stop tRNA from doing its job would mean what? A. that ribosomes would fall apart B. that sugars would not be added to proteins C. that nothing would be available to translate D. that amino acids would not be brought to the growing proteinarrow_forwardA single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.arrow_forward
- What is the role of transcription in the determination of the amino acid sequence of a polypeptide chain? A. It pairs anticodons and codons. B. It synthesizes an mRNA strand. C. It duplicates the information in DNA. D. It decodes the information from mRNA.arrow_forwardImagine that a mutation in a DNA molecule results in the codon CCU being changed to CCC. Both of these codons code for proline. The fact that more than one codon can code for the same amino acid is referred to as ___ a. the ambiguity of the genetic code b. the redundancy of the genetic code c. the randomness of the genetic code d. mutations in the genetic codearrow_forwardAfter ingesting a bacteria, macrophages process bacterial parts and ‘present’ them to acquired immunity cells so the acquired immune cells recognize these invaders again in the future. The antigen-presenting proteins ultimately end up in the plasma membrane. Where did it receive the post-translation modification that determined its final location? a. The ribosome b. The ER c. The Golgi d. The vesiclearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY