![Pearson Etext Becker's World Of The Cell -- Access Format: Access Code Card](https://www.bartleby.com/isbn_cover_images/9780134873664/9780134873664_smallCoverImage.jpg)
Pearson Etext Becker's World Of The Cell -- Access Format: Access Code Card
9th Edition
ISBN: 9780134873664
Author: Hardin, Jeff^bertoni, Gregory Paul^kleinsmith, Lew
Publisher: Prentice Hall
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 16, Problem 16.5PS
DNA Renaturation. You are given two samples of DNA, each of which melts at 92°C during thermal denaturation. After denaturing the DNA, you mix the two samples together and then cool the mixture to allow the DNA strands to reassociate. When the newly reassociated DNA is denatured a second time, the sample now melts at 85°C.
(a) How might you explain the lowering of the melting temperature from 92°C to 85°C?
(b) If the newly reassociated DNA had melted at 92°C instead of 85°C, what conclusions might you have drawn concerning the base sequences of the two initial DNA samples?
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
True or False. Each time the genome is replicated, half the newly synthesized DNA is stitched together from Okazaki fragments. Explain your answer in 1-2 sentences.
Please help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5
determine what amino acid will be formed from the given DNA strand below:
3’ T A C A T G C C G A A T G C C 5’
Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain.
1. Partner DNA strand
2. the mRNA strand
3. The tRNA
4. the formed amino acids
5. the discussion of the entire procedure
Close contact. Examination of the structure of DNA polymerases
bound to nucleotide analogs reveals that conserved residues come
within van der Waals contact of C-2'C-2' of the bound nucleotide.
What is the potential significance of this interaction?
Chapter 16 Solutions
Pearson Etext Becker's World Of The Cell -- Access Format: Access Code Card
Ch. 16 - Based on what you know about protein and DNA, why...Ch. 16 - The GC content of the DNA from a newly discovered...Ch. 16 - Prob. 1QCh. 16 - Changes in chromatin packing correlate with...Ch. 16 - You are studying a cytosolic protein, and your...Ch. 16 - Prior Knowledge. Virtually every experiment...Ch. 16 - DNA Base Composition. Based on your understanding...Ch. 16 - DNA Structure. Carefully inspect the...Ch. 16 - QUANTITATIVE DNA Melting. Figure 16-36 shows the...Ch. 16 - DNA Renaturation. You are given two samples of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Please help me with this please. I really don't know how to make this. I really do appreciate you're help. 1. make a simple illustration to relate the different kinds of DNA to its function.arrow_forwardIn DNA extracting. What is the purpose of clear shampoo in the DNA extraction buffer?arrow_forwardIn the DNA extraction. What is the role of alcohol in the DNA extraction process?arrow_forward
- Draw a replication bubble. Be sure to label the directionality of all strands of DNA. For one of the two replication forks, draw and label all of the proteins required the text describes as being important for DNA synthesis, and label the leading and lagging strands.arrow_forwardTRUE OR FALSE. Studies have confirmed that damaged to both the double strands can be reversed via single stranded annealing.arrow_forwardQuestion. What would the forward primer sequence look like if it were intended to bind the area of the DNA template?arrow_forward
- True or False. In a comparison between the DNAs of related organisms such as humans and mice, conserved sequences represent functionally important exons and regulatory regions, and non-conserved sequences generally represent noncoding DNA. Explain your answer in 2-3 sentences.arrow_forwardelearn.squ.edu.om/mod/qu NG SYSTEM (ACADEMIC) Time left 0:44:39 If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. GCGCGCGCGCGCGCGCGCGCG O b. GGGGGCCCCCAATTCCCCCCC O c. AAAAAATTTTTCCCCCGGGGG O d. TACTACACTGTGGTTAATTAAA O e. ATATATATCGCGTTAAATTCTA CLEAR MY CHOICE Match the given words with the most suitable words from the given list. Unicellular fungi Hyphae Choose..arrow_forwardN. NH 2. One of the key pieces of information that Watson and Crick used in determining the secondary structure of DNA came from experiments done by E. Chargaff, in which he studied the nucleotide composition of DNA from many different species. O=P-OCH, N. `NH, HN он O= P- OCH, NH, Chargaff noted that the molar quantity of A_was always approximately equal to the molar quantity of T. and the molar quantity of C was always approximately equal to the molar quantity of G. How were Chargaff's results explained by the structural model of DNA proposed by Watson and Crick? N OH N. O= P-OCH, OH OHarrow_forward
- no explanation necessary! Letter of answer only. Part I: Multiple choice 1. The DNA base pairing rules are: a) Any combination of the bases. b) T pairs with C, and A pairs with G. c) A pairs with T, and C pairs with G. d) C pairs with A, and T pairs with G. 2. DNA in cells is damaged: a) Millions of times a day. b) By collisions with other molecules or by chemical accidents and radiation. c) Not very often¸ and by radiation only. d) a and b 3. For genes that code for proteins, which molecule conveys the information from the gene to the ribosome? a) DNA b) mRNA c) tRNA d) rRNA 4. Which of the molecules below is produced during replication? a) mRNA b) rRNA c) tRNA d) DNA 5. Why is there a difference between the synthesis of a lead strand and that of a discontinuous strand in DNA molecules? a) The origins of replication are found only at end 5' of the molecule. b) Helicase and protein factors act at the extremity of 5'. c) DNA polymerases can only add new nucleotides at the extremity 3' a…arrow_forwardPstl. EcoRI Origin of replication (ori) Ampicillin Tetracycline resistance resistance (Amp) (Tet") pBR322 (4,361 bp) BamHI Pvull Sall Recombinant Plasmid DNA Bacterial cell contains... No plasmid DNA pBR322 (no insert) Recombinant plasmid 00,000. Host DNA Transformation of E. coli cells +AMP plate pBR322 Figure 7-5 +TET plate Based on the recombinant plasmid growth pattern (bottom row of blue table), which of the depicted plasmid's restriction sites was used to prepare this sample? Explain how you can tell.arrow_forwardTrue or False. Topoisomerase I does not require ATP to break and rejoin DNA strands because the energy of the phospho-diester bond is stored transiently in a phospho-tyrosine linkage in the enzyme’s active site. Explain your answer in 2-3 sentences.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY