Pearson Etext Becker's World Of The Cell -- Access Format: Access Code Card
9th Edition
ISBN: 9780134873664
Author: Hardin, Jeff^bertoni, Gregory Paul^kleinsmith, Lew
Publisher: Prentice Hall
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 16, Problem 16.6PS
Nucleosomes. You perform an experiment in which chromatin is isolated from sea urchin sperm cells and briefly digested with micrococcal nuclease. When the chromatin proteins are removed and the resulting purified DNA is analyzed by gel electrophoresis, you observe a series of DNA fragments that are multiples of 260 base pairs in length (that is, 260 bp, 520 bp, 780 bp, and so forth).
- (a) Although these results differ somewhat from the typical results discussed in the chapter, explain why they still point to the likely existence of nucleosomes in this cell type.
- (b) What can you conclude about the amount of DNA that is associated with each nucleosome?
- (c) Suppose you perform an experiment in which the chromatin is digested for a much longer period of time with micrococcal nuclease before removal of chromatin proteins. When the resulting DNA preparation is analyzed by electrophoresis, all of the DNA appears as fragments 146 bp in length. What does this suggest to you about the length of the linker DNA in this cell type?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Original sequence:
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start):
5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’
Question:
4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this?
5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
Draw a replication bubble. Be sure to label the directionality of all strands of DNA. For one of the two replication forks, draw and label all of the proteins required the text describes as being important for DNA synthesis, and label the leading and lagging strands.
Backward? Bacteriophage T7 helicase moves along DNA in the 5'-to-
3'5'-to-3' direction. Other helicases have been reported to move in
the 3'-to-5'3'-to-5' direction. Is there any fundamental reason why
you would expect helicases to move in one direction or the other?
Chapter 16 Solutions
Pearson Etext Becker's World Of The Cell -- Access Format: Access Code Card
Ch. 16 - Based on what you know about protein and DNA, why...Ch. 16 - The GC content of the DNA from a newly discovered...Ch. 16 - Prob. 1QCh. 16 - Changes in chromatin packing correlate with...Ch. 16 - You are studying a cytosolic protein, and your...Ch. 16 - Prior Knowledge. Virtually every experiment...Ch. 16 - DNA Base Composition. Based on your understanding...Ch. 16 - DNA Structure. Carefully inspect the...Ch. 16 - QUANTITATIVE DNA Melting. Figure 16-36 shows the...Ch. 16 - DNA Renaturation. You are given two samples of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Pstl. EcoRI Origin of replication (ori) Ampicillin Tetracycline resistance resistance (Amp) (Tet") pBR322 (4,361 bp) BamHI Pvull Sall Recombinant Plasmid DNA Bacterial cell contains... No plasmid DNA pBR322 (no insert) Recombinant plasmid 00,000. Host DNA Transformation of E. coli cells +AMP plate pBR322 Figure 7-5 +TET plate Based on the recombinant plasmid growth pattern (bottom row of blue table), which of the depicted plasmid's restriction sites was used to prepare this sample? Explain how you can tell.arrow_forwardA. DNA Replication Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the parent DNA (3' to 5') strand correspond to a start codon and its last three nucleotides correspond to a stop codon in its MRNA counterpart later on.) Write it down as follows: a. the sequence of parent DNA (template) 3' A C A TT 5' 3' Upon undergoing DNA replication, show what one daughter DNA molecule will look like. Write it down as follows: b. the sequence of DNA Daughter 1: 3' 5' 5' 3' C. the sequence of DNA Daughter 2: 3' 3' 5' in inarrow_forward. Pancreatic deoxyribonuclease I (DNase I) is a nuclease that makes single-strand nicks on double-stranded DNA. It has been observed that treatment of nucleosomal core particles with DNase I yields a peculiar result. When DNA from such a digestion is electrophoresed under denaturing conditions, the single-stranded fragments are observed to occur in a regular periodicity of about 10 bases. Suggest an explanation of this result in terms of the structure of the nucleo- some.arrow_forward
- Show all work. 1. A) Produce a double-stranded piece of DNA that is 11 base pairs long using the letters A, C, G, T and label the ends of both strands using 3' and 5' appropriately. B) Calculate the ratio of (A+T)/(G+C) and (A+G)/(C+T). Explain why one ratio will always be equal to 1.0?arrow_forwardTrue or False. Explain. A) At no time during protein synthesis does an amino acid make direct contact with the mRNA being translated. B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.arrow_forwardIn DNA extracting. What is the purpose of clear shampoo in the DNA extraction buffer?arrow_forward
- Restriction sites of Lambda (A) DNA - In base pairs (bp) The sites at which each of the 3 different enzymes will cut the same strand of lambda DNA are shown in the maps (see figure 3 B-D), each vertical line on the map is where the respective enzymes will cut. A DNA A (bp) 48502 10 000 20 000 30 000 40 000 9162 17 198 B Sal I 7059 14 885 28 338 35 603 42 900 (bp) Hae III 11 826 21 935 29 341 38 016 (bp) 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864 Figure 3: Restrictrion site map showing the following A) inear DNA that is not cut as reference B) DNA CLt with Sal L C) DNA cut with Hae , D) DNA cut with Eco RI 1. Calculate the size of the resulting fragments as they will occur after digestion and write the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp (see figure 3A). Page 3 of 7 9162 17 198 Sal i (bp) 7059 14 885 28 338 35 603 42 900 Hae I (bp) 11 826 21 935 29 341 38 016 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864arrow_forward1a. What do DNA polymerases need to be able to synthesize a new strand of DNA? In 1970, Fred Sanger and colleagues published a DNA sequencing procedure based on the principles of DNA replication. This procedure uses in vitro DNA synthesis in the presence of radioactive nucleotides and specific chain-terminators. These specific chain terminators lack a 3' hydroxyl group and are called 2', 3' – dideoxyribonucleoside triphosphates. This means that once a chain terminator is built into the newly synthesized strand, no further synthesis can occur on that particular strand. They are most usually labelled with radioactive 355 (isotope 35 of sulphur). Four reactions are assembled, each containing one each of 2', 3' - dideoxythymidine triphosphate (ddTTP), ddCTP, ddATP or ddGTP. In each reaction tube, all the fragments will end with same base (T, C, A or G). These reactions are each loaded in their own lane and separated by gel electrophoresis, exposed to autoradiograph film (X-ray film) and…arrow_forwardRecall the DNA’s three-dimensional model. The DNA is a right-handed helix wherein onecomplete 360 0 turn covers a distance of 34 angstroms (Å) or 3.4 nm and 10 base pairs. As a result, thebase pairs are separated by a distance of approximately 3.4 Å. The diameter of the Watson and CrickDNA molecule is 20 Å.Calculate the average number of nucleotide pairs (or base pairs) per micrometer of DNA doublehelix according to the dimension mentioned above. Round off your answer to the nearest wholenumber. Note also that 1 micrometer = 10,000 angstroms.arrow_forward
- An extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.arrow_forwardTyr- The starting substrate and active site of a Type I topoisomerase is shown below. During this reaction, a small molecule is introduced that removes free hydroxyl groups from DNA (but not protein). Please draw the resulting product under these conditions, including the arrow pushing mechanisms that lead to the product(s). s' CH₂ DNA Base O 111110 H CH₂ Basearrow_forwardRecall the DNA’s three-dimensional model. The DNA is a right-handed helix wherein one complete 3600 turn covers a distance of 34 angstroms (Å) or 3.4 nm and 10 base pairs. As a result, the base pairs are separated by a distance of approximately 3.4 Å. The diameter of the Watson and Crick DNA molecule is 20 Å.Calculate the average number of nucleotide pairs (or base pairs) per micrometer of DNA double helix according to the dimension mentioned above. Round off your answer to the nearest whole number. Note also that 1 micrometer = 10,000 angstroms.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license