WORLD OF CELL+MASTERING ACCESS >CUSTOM
9th Edition
ISBN: 9781323445044
Author: Hardin
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 16, Problem 16.5PS
DNA Renaturation. You are given two samples of DNA, each of which melts at 92°C during thermal denaturation. After denaturing the DNA, you mix the two samples together and then cool the mixture to allow the DNA strands to reassociate. When the newly reassociated DNA is denatured a second time, the sample now melts at 85°C.
(a) How might you explain the lowering of the melting temperature from 92°C to 85°C?
(b) If the newly reassociated DNA had melted at 92°C instead of 85°C, what conclusions might you have drawn concerning the base sequences of the two initial DNA samples?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
True or false ? Reactions in our cells happen in a perfect way, therefore DNA replication is error free
INSTRUCTION: Given the DNA sequence below, provide the answers to the following items.
a. complimentary DNA strand
1.) G A A A T G A C C A G A T T T A T G G C C T G A
2). A T G C G A C C T T A A G T C A A T T G C G A C
b. mRNA
1.) G A A A T G A C C A G A T T T A T G G C C T G A
2). A T G C G A C C T T A A G T C A A T T G C G A C
c. protein synthesized
1.) G A A A T G A C C A G A T T T A T G G C C T G A
2). A T G C G A C C T T A A G T C A A T T G C G A C
May you please help me with this?
A sample of purified DNA was incubated with deoxyribonuclease (DNAse) at 37oC. An
aliquot was removed from the reaction mixture every minute for 5 minutes and
the A260 recorded. The following data were obtained.
Time (min) A260
0 0.60
1 0.64
2 0.67
3 0.70
4 0.72
5 0.73
Describe the action of deoxyribonuclease on DNA and explain the increase in
A260.
Chapter 16 Solutions
WORLD OF CELL+MASTERING ACCESS >CUSTOM
Ch. 16 - Based on what you know about protein and DNA, why...Ch. 16 - The GC content of the DNA from a newly discovered...Ch. 16 - Prob. 1QCh. 16 - Changes in chromatin packing correlate with...Ch. 16 - You are studying a cytosolic protein, and your...Ch. 16 - Prior Knowledge. Virtually every experiment...Ch. 16 - DNA Base Composition. Based on your understanding...Ch. 16 - DNA Structure. Carefully inspect the...Ch. 16 - QUANTITATIVE DNA Melting. Figure 16-36 shows the...Ch. 16 - DNA Renaturation. You are given two samples of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Question:- Explain why there are very few sequence-specific DNA-binding proteins that bind to the minor groove of double-stranded DNA.arrow_forwardNot just generic "degradation" or even shorter DNA fragments, what specific structure change in double-stranded DNA does the hyperchromicity effect show?arrow_forwardCalculating human genome If 1.5 percent of the human genome consists of protein-coding sequences, and the entire genome has 3.2x10^9, how many codons are there in the human genome? Remember that a codon is three nucleotides in length.arrow_forward
- Central Dogma of Molecular Biology from DNA to RNA to Protein, discussing the principles underlying the transfer of information in a biologic system and its regulation. However, recent research seems to challenge certain aspects of Crick’s Central Dogma. Does the Central Dogma still stand today? If not, can you find an example for a type of information transfer that is not explicitly covered by the Central Dogma (or even violates it)?arrow_forwardNumber of Okazaki Fragments in E. coli and Human DNA Replication Approximately how many Okazaki fragments are synthesized in the course of replicating an E. coli chromosome? How many in replicating an “averageâ€� human chromosome?arrow_forwardTick the correct statements: Remember: Tautomers are structural isomers that differ from each other based on the position of the proton(s) and their double bonds. ( ) The nitrogenous bases of nucleic acids, which contain heterocyclic and analogous nuclei, can adopt different tautomeric forms involving multiple H+ that are exchangeable depending on the medium. In DNA, spontaneous formation of smaller tautomers appears to contribute to mutagenic errors during DNA replication, while in RNA, they seem to be related to increased structural and functional diversity of enzymes and RNA aptamers (research this and confirm if it is false or real) ( ) in relation to the figure, anomer 1 has beta stereochemistry with respect to the C anomeric of the pentose, and is making an N-glycosidic bond ( ) in relation to the figure, anomer 1 has alpha stereochemistry with respect to the C anomeric of the pentose, and is making an N-glycosidic bond ( ) In general, in naturally occurring nucleosides,…arrow_forward
- a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =arrow_forwardSemiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.arrow_forwardThe chemical structure of DNA, why wouldn't the bases pair with a different base instead of the one in base pairing rule?arrow_forward
- DNA: Why does histone modifications matter?arrow_forwardmutation simulationarrow_forwardComposition as a mole fraction of one of a double-stranded DNA strand T = 0.22 and C = 0.30. In the light of this information, the following values are Calculate as a fraction. If the given information is used to calculate the desired value, If it is not sufficient, indicate the result as X.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY