WORLD OF CELL+MASTERING ACCESS >CUSTOM
9th Edition
ISBN: 9781323445044
Author: Hardin
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 16, Problem 16.6PS
Nucleosomes. You perform an experiment in which chromatin is isolated from sea urchin sperm cells and briefly digested with micrococcal nuclease. When the chromatin proteins are removed and the resulting purified DNA is analyzed by gel electrophoresis, you observe a series of DNA fragments that are multiples of 260 base pairs in length (that is, 260 bp, 520 bp, 780 bp, and so forth).
- (a) Although these results differ somewhat from the typical results discussed in the chapter, explain why they still point to the likely existence of nucleosomes in this cell type.
- (b) What can you conclude about the amount of DNA that is associated with each nucleosome?
- (c) Suppose you perform an experiment in which the chromatin is digested for a much longer period of time with micrococcal nuclease before removal of chromatin proteins. When the resulting DNA preparation is analyzed by electrophoresis, all of the DNA appears as fragments 146 bp in length. What does this suggest to you about the length of the linker DNA in this cell type?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Question:-
Explain why there are very few sequence-specific DNA-binding proteins that bind to the minor groove of double-stranded DNA.
Calculating human genome
If 1.5 percent of the human genome consists of protein-coding sequences, and the entire genome has 3.2x10^9, how many codons are there in the human genome? Remember that a codon is three nucleotides in length.
INSTRUCTION: Given the DNA sequence below, provide the answers to the following items.
a. complimentary DNA strand
1.) G A A A T G A C C A G A T T T A T G G C C T G A
2). A T G C G A C C T T A A G T C A A T T G C G A C
b. mRNA
1.) G A A A T G A C C A G A T T T A T G G C C T G A
2). A T G C G A C C T T A A G T C A A T T G C G A C
c. protein synthesized
1.) G A A A T G A C C A G A T T T A T G G C C T G A
2). A T G C G A C C T T A A G T C A A T T G C G A C
Chapter 16 Solutions
WORLD OF CELL+MASTERING ACCESS >CUSTOM
Ch. 16 - Based on what you know about protein and DNA, why...Ch. 16 - The GC content of the DNA from a newly discovered...Ch. 16 - Prob. 1QCh. 16 - Changes in chromatin packing correlate with...Ch. 16 - You are studying a cytosolic protein, and your...Ch. 16 - Prior Knowledge. Virtually every experiment...Ch. 16 - DNA Base Composition. Based on your understanding...Ch. 16 - DNA Structure. Carefully inspect the...Ch. 16 - QUANTITATIVE DNA Melting. Figure 16-36 shows the...Ch. 16 - DNA Renaturation. You are given two samples of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Number of Okazaki Fragments in E. coli and Human DNA Replication Approximately how many Okazaki fragments are synthesized in the course of replicating an E. coli chromosome? How many in replicating an “averageâ€� human chromosome?arrow_forwarda. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =arrow_forwardDNA: Why does histone modifications matter?arrow_forward
- Central Dogma of Molecular Biology from DNA to RNA to Protein, discussing the principles underlying the transfer of information in a biologic system and its regulation. However, recent research seems to challenge certain aspects of Crick’s Central Dogma. Does the Central Dogma still stand today? If not, can you find an example for a type of information transfer that is not explicitly covered by the Central Dogma (or even violates it)?arrow_forwardVISUALIZE Sketch a pyrimidine nucleotide subunit that would be found only in RNA. Circle and label the three components that make up this type of nucleotide. Explain what changes in the functional groups of this subunit would have to occur for it to be found in a DNA molecule.arrow_forwardHow many sites? A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-base-pair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explainarrow_forward
- Biochemist Erwin Chargaff was the first to note that, in DNA, [A] = [T] and [G]= [C], equalities now called Chargaff’s rule. Using this rule, determine the percentages of all the bases in DNA that is 20% thymine.arrow_forwardCOMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGCarrow_forwardTick the correct statements: Remember: Tautomers are structural isomers that differ from each other based on the position of the proton(s) and their double bonds. ( ) The nitrogenous bases of nucleic acids, which contain heterocyclic and analogous nuclei, can adopt different tautomeric forms involving multiple H+ that are exchangeable depending on the medium. In DNA, spontaneous formation of smaller tautomers appears to contribute to mutagenic errors during DNA replication, while in RNA, they seem to be related to increased structural and functional diversity of enzymes and RNA aptamers (research this and confirm if it is false or real) ( ) in relation to the figure, anomer 1 has beta stereochemistry with respect to the C anomeric of the pentose, and is making an N-glycosidic bond ( ) in relation to the figure, anomer 1 has alpha stereochemistry with respect to the C anomeric of the pentose, and is making an N-glycosidic bond ( ) In general, in naturally occurring nucleosides,…arrow_forward
- Typed explanation only Codons in mRNA molecule and their corresponding amino acids UUU Phenylalanine UAU tyrosine UUA leucine UAA nonsense GCA alanine AAU asparagine AAG lysine UGC cysteine GUU valine UCG, UCU serine Refer to Table 8.2. If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Group of answer choices 5' TGTGCTTTCTTA 3' 3' AGACGTTTCAAT 5' 3' UGUGCAAAGUUA 5' 5' AGAGCTTTGAAT 3' 3' TCTCGTTTGTTA 5'arrow_forwardYes or no? for each gene, transcription is initiated at origin of replication. does pre mrna shorter than mrna? Does one thousand microliters less than a milliliter?arrow_forwardNot just generic "degradation" or even shorter DNA fragments, what specific structure change in double-stranded DNA does the hyperchromicity effect show?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license