Life: The Science of Biology
11th Edition
ISBN: 9781319010164
Author: David E. Sadava, David M. Hillis, H. Craig Heller, Sally D. Hacker
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 17, Problem 3Q
Summary Introduction
To review:
The level of activity of the enzyme coded by ‘A’ allele compared to the enzyme coded by ‘G’ allele.
Given:
In the given experiment, the rate of
Introduction:
The metabolism of drug is effective in people with genotype GG where drug concentration in the blood is around 70. The drug concentration for the genotype AG is around 100 and it is around 130 for AA genotype. It is assumed that the SNP 5689 is present in a gene, which encodes an enzyme. This enzyme breaks down the drug.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
(a) Is it biologically advantageous that DNAis stable? Why or why not? (b) Is it biologically advantageous thatRNA is unstable? Why or why not?
Assume that a DNA sequencing reaction is carried out, except that the four different dideoxyribonucleoside triphosphates are modified so that each contains a covalently attached dye of a different color (which does not interfere with its incorporation into the DNA chain). What would the products be if you added a mixture of all four of these labeled dideoxyribonucleoside triphosphates along with the four unlabeled deoxyribonucleoside triphosphates into a single sequencing reaction? What would the results look like if you electrophoresed these products in a single lane of a gel?
Based on the information in as shown, which single-nucleotide mutationevent is more likely: Arg-to-His, or Arg-to-Ser? Explain.
Chapter 17 Solutions
Life: The Science of Biology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. 1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explainarrow_forwardAs part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. (a) Give TWO possible causes of your protein becoming truncated. explainarrow_forwardLet’s suppose you make a transposon library of the cellulose-secreting bacterium Komagataeibacter xylinus, with the goal of finding mutants that produce higher than normal amounts of cellulose, which would be useful industrially. However, despite your best efforts you are unable to isolate any transposon mutants that make more cellulose than the wild-type strain.Why might this have failed? List as many reasons as you can think of.arrow_forward
- Suppose that a nearly perfect 20-base-pair inverted repeat is observed in a DNA sequence. Provide two possible explanations.arrow_forwardThe structure of adenylate cyclase is similar to the structures of some types of DNA polymerases, suggesting that these enzymes derived from a common ancestor. Compare the reactions catalyzed by these two enzymes. In what ways are they similar?arrow_forwardThe E. coli genome contains 1009 Chi sequences. Do these sequences occur at random, and, if not, how much more or less frequently than random do they occur?arrow_forward
- This shows where EcoR1 cuts, where HindIII cuts, and where BstEII cuts. Given that the entire chromosome is 48,502 base pairs (as it says), figure out the fragment sizes you will expect if you cut it with EcoR1, or with HindIII, or with BseEII. Draw a map like the example attached " Show the sizes of each piece. Color code it according to which enzyme cut it.arrow_forwardThe chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?arrow_forwardFrom Table 20-3, would you expect the noncoding mutation g4205a to be fixed before or after the coding mutation G238S in a population of bacteria evolving resistance to the antibiotic cefotaxime? Give at least tworeasons for your answer.arrow_forward
- As shown under each graph in this image, particular transversions (replacement of a pyrimidine by a purine of vice versa) or transitions (replacement of a purine or pyrimidine by the alternative purine or pyrimidine) are features of specific mutational signatures. Based on these data, identify the transversion or transition that seems to be induced by cigarette smoke.arrow_forwardWhat can you determine from the r-value about the relationship between gene copy number and amylase enzyme concentration? r value = 0.935833048arrow_forwardGiven the partial transposons DNA sequence 5’-ACCGTATTCGGT-3’ upstream from the central region, assuming both terminal inverted repeats and flanking direct repeats have 6 base pairs, hypothetically write the transposon structure downstream from the central region.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY