ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
6th Edition
ISBN: 9781260406092
Author: HARTWELL, Leland, HOOD, Leroy, Goldberg, Michael
Publisher: Mcgraw-hill Education/stony Brook University
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 17, Problem 4P
Which eukaryotic RNA polymerase (RNA pol I, pol II, or pol III) transcribes which genes?
a. | tRNAs |
b. | mRNAs |
c. | rRNAs |
d. | miRNAs |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Which eukaryotic RNA polymerase (RNA pol I,pol II, or pol III) transcribes which genes?a. tRNAsb. mRNAsc. rRNAsd. miRNAs
If eukaryotes have monocistronic genes, why is the number of known proteins more than the number of known genes?
A. Post-translational modification
B. Alternative splicing
C. Base substitution
D. Post-transcriptional modification
Select the most complete list of correct structures involved in the process of transcription
a.
mRNA, amino acids, ribosomes, polypeptide chains
b.
DNA, mRNA, RNA polymerase, a promoter
c.
mRNA, polypeptide chains, RNA polymerase
d.
DNA, mRNA, amino acids
Chapter 17 Solutions
ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
Ch. 17 - For each of the terms in the left column, choose...Ch. 17 - For each of the following types of gene...Ch. 17 - List five events other than transcription...Ch. 17 - Which eukaryotic RNA polymerase RNA pol I, pol II,...Ch. 17 - As shown in the following diagram, a single...Ch. 17 - You have synthesized an enhancerless GFP reporter...Ch. 17 - Prob. 7PCh. 17 - Prob. 8PCh. 17 - A single UAS regulates the expression of three...Ch. 17 - MyoD is a transcriptional activator that turns on...
Ch. 17 - a. Assume that two transcription factors are...Ch. 17 - Prob. 12PCh. 17 - In Problem 12, you identified a genomic region...Ch. 17 - Prob. 14PCh. 17 - Prob. 15PCh. 17 - Genes in both prokaryotes and eukaryotes are...Ch. 17 - Prob. 17PCh. 17 - Lysine 4 of histone H3 H3K4 is methylated in the...Ch. 17 - J.T. Lis and collaborators have developed an...Ch. 17 - Hydatiform moles are growths of undifferentiated...Ch. 17 - Prader-Willi syndrome is caused by a mutation in...Ch. 17 - The human IGF2 gene is autosomal and maternally...Ch. 17 - Follow the expression of a paternally imprinted...Ch. 17 - Reciprocal crosses were performed using two inbred...Ch. 17 - Interestingly, imprinting can be tissue-specific....Ch. 17 - Prob. 26PCh. 17 - A method for detecting methylated CpGs involves...Ch. 17 - Honeybees Apis mellifera provide a striking...Ch. 17 - Consider the experiment in Fig. 17.24, where the...Ch. 17 - A protein or RNA that regulates gene expression in...Ch. 17 - a. How can a single eukaryotic gene give rise to...Ch. 17 - A hunchback gene, a gene necessary for proper...Ch. 17 - You know that the mRNA and protein produced by a...Ch. 17 - You are studying a transgenic mouse strain that...Ch. 17 - Prob. 35PCh. 17 - Scientists have exploited the siRNA pathway to...Ch. 17 - Persimmons Diospyros lotus are dioecious plants,...Ch. 17 - Drosophila females homozygous for loss-of-function...Ch. 17 - The text has discussed the RNA-Seq technique,...Ch. 17 - Researchers know that Fru-M controls male sexual...Ch. 17 - The Drosophila gene Sex lethal Sxl is deserving of...Ch. 17 - Figure 17.29 shows that the Sxl protein binds to...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which type of RNA comprises over 80% of total cellular RNA? A. ribosomal RNA B. Messenger RNA C. Transfer RNAarrow_forwardWhat transcripts will be most affected by low levels of α- amanitin? a. 18S and 28S rRNAs b. pre-mRNAs c. 5S rRNAs and tRNAs d. other small nuclear RNAsarrow_forwardGiven is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?arrow_forward
- In RNA silencing, siRNAs and miRNAs usually bind to which part of the mRNA molecules that they control? a. 5′ UTR b. Coding region c. 3′ poly(A) tail d. 3′ UTRarrow_forwardGiven is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this mRNA?d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?arrow_forwardWhy might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic mRNA? a. If the mutation occurs in the 5' end of the start site, it will not affect the gene product. b. If the mutation occurs in the exon, it will not affect the gene product. c. If the mutation occurs in the splice site of a transcript with alternative splicing, only one gene product may affected. O d. If the mutation occurs in the intron or not in the splice site of a transcript with alternative splicing, it will nc affect the gene product. O e. If the mutation occurs in the 3' end of the start site, it will not affect the gene product. OLIE STIC N 1Aarrow_forward
- What is the correct tRNA anti-codon sequence for the AUG mRNA sequences? a. UGA b. UAC c. CAU d. AUGarrow_forwardUse the pre-mRNA sequence shown below to answer the following questions. MRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3' a. Underline the 5' and 3' splice sites, then write the sequence of the spliced mRNA in the space provided. b. Predict what would happen if the G in the 5' splice site were mutated to a C. c. We learned in this topic that the 5' cap in an mRNA plays a role in translation initiation. What do you think is one plausible mechanism by which a 5' cap can enhance initiation ? How can you experimentally demonstrate that a 5' cap is important for this process ?arrow_forwardThe AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? a. complementarity b. nonsense codons c. universality d. degeneracyarrow_forward
- Which post-transcriptional modification is NOT shared by all eukaryotic RNAs? a. Modifying bases b. Removing RNA stretches c. Adding of terminal sequences d. all of the abovearrow_forwardResearchers screening the blood of an advanced prostate cancer patient identified a 21 base pair long RNA molecule deemed to be potential importance as a biomarker of disease. Subsequent experiments using this molecule showed that it decreased retinoblastoma (Rb) protein levels. Based on this activity, what type of RNA is this molecule? A. Transfer RNA B. Micro RNA C. Circular RNA D. Ribosomal RNA E. Messenger RNAarrow_forwardWhich of the following statements below is incorrect? * A. the genetic code is overlapping B. the genetic code is universal C. degenerate codon specify the same amino acids D. the genetic code is triplet Which protein can break covalent bond? * A. Helicase B. Primase C. SSB D. DNA gyrase What is the complementary hnRNA base sequence produced from the DNA base sequence 5' C-T-A-T-A-C 3'? * A. 3' C-A-T-A-T-C 5' B. 3' G-A-T-A-T-G 5' C. 3' G-A-U-A- U-G 5' D. 3' C-U-A-U-A-G 5' Which of the following statements concerning the " cloverleaf" shape of tRNA molecules is correct? * A. four hairpin loops are present B. three hairpin loops and one open end are present C. two hairpin loops and two open ends are present…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY