ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
6th Edition
ISBN: 9781260406092
Author: HARTWELL, Leland, HOOD, Leroy, Goldberg, Michael
Publisher: Mcgraw-hill Education/stony Brook University
expand_more
expand_more
format_list_bulleted
Question
Chapter 17, Problem 7P
Summary Introduction
To determine:
The region that contains the promoter and a neuronal enhancer in the tissue culture.
Introduction:
The promoter is a small DNA sequence where the RNA polymerase enzyme bind for the process of transcription. The prokaryotes have TATA box and Pribnow box as their promoter regions. These are unaltered and conserved sequences.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
You made four mutants for a promoter sequence in DNA and studied them for transcription. The results of the amount of gene expression or transcription (based on beta-Gal activity shown on Y-axis) for these DNAs (X-axis) are shown. The sequence of the wild-type and mutant DNAs, and consensus sequence from many promoters are shown here for your convenience.
From this experiment you can conclude that:
Nucleotide substitution can identify important bases of the binding sites or promoter in DNA (e.g., -10 and -35 promoter sequences of lac operon).
True or false:
Spacer
(a)
-10 region
-35 region
TTGACA
Consensus sequence
TATAAT
Wild-type Lac promoter GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATT
Mutant 1 GGCTTTACACTTTATG-TTCCGGCTCGTATGTTGTGTGGAATT
Mutant 2 GGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATT
Mutant 3 GGCTTTACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT
Mutant 4 GGCTTGACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT
(b)
700
600-
500-
400-
300-
200-
100.
0
● True
O False
B-Galactosidase activity
Wild-type…
An electrophoretic mobility shift assay can be used to
study the binding of proteins to a segment of DNA. In
the results shown here, an EMSA was used to
examine the requirements for the binding of RNA
polymerase |l (from eukaryotic cells) to the promoter of
a protein-encoding gene. The assembly of general
transcription factors and RNA polymerase Il at the core
promoter is described in Week 4. In this experiment,
the segment of DNA containing a promoter sequence
was 1100 bp in length. The fragment was mixed with
various combinations of proteins and then subjected to
an EMSA.
Lane 1: No proteins added
Lane 2: TFIID
Lane 3: TFIIB
Lane 4: RNA polymerase IIl
Lane 5: TFIID + TFIIB
Lane 6: TFIID + RNA
1
2
3
4
5
6.
7
polymerase II
Lane 7: TFIID +
TFIIB + RNA
polymerase Il
1100 bp
Explain the results.
You then make a screen to identify potential mutants (shown as * in the diagram) that are able to constitutively activate Up Late operon in the absence of Red Bull and those that are not able to facilitate E. Coli growth even when fed Red Bull. You find that each class of mutations localize separately to two separate regions. For those mutations that prevent growth even when fed Red Bull are all clustered upstream of the core promoter around -50 bp. For those mutations that are able to constitutively activate the operon in the absence of Red Bull are all located between the coding region of sleep and wings. Further analysis of each DNA sequence shows that the sequence upstream of the promoter binds the protein wings and the region between the coding sequence of sleep and wings binds the protein sleep. When the DNA sequence of each is mutated, the ability to bind DNA is lost. Propose a final method of gene regulation of the Up Lateoperon using an updated drawn figure of the Up Late…
Chapter 17 Solutions
ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
Ch. 17 - For each of the terms in the left column, choose...Ch. 17 - For each of the following types of gene...Ch. 17 - List five events other than transcription...Ch. 17 - Which eukaryotic RNA polymerase RNA pol I, pol II,...Ch. 17 - As shown in the following diagram, a single...Ch. 17 - You have synthesized an enhancerless GFP reporter...Ch. 17 - Prob. 7PCh. 17 - Prob. 8PCh. 17 - A single UAS regulates the expression of three...Ch. 17 - MyoD is a transcriptional activator that turns on...
Ch. 17 - a. Assume that two transcription factors are...Ch. 17 - Prob. 12PCh. 17 - In Problem 12, you identified a genomic region...Ch. 17 - Prob. 14PCh. 17 - Prob. 15PCh. 17 - Genes in both prokaryotes and eukaryotes are...Ch. 17 - Prob. 17PCh. 17 - Lysine 4 of histone H3 H3K4 is methylated in the...Ch. 17 - J.T. Lis and collaborators have developed an...Ch. 17 - Hydatiform moles are growths of undifferentiated...Ch. 17 - Prader-Willi syndrome is caused by a mutation in...Ch. 17 - The human IGF2 gene is autosomal and maternally...Ch. 17 - Follow the expression of a paternally imprinted...Ch. 17 - Reciprocal crosses were performed using two inbred...Ch. 17 - Interestingly, imprinting can be tissue-specific....Ch. 17 - Prob. 26PCh. 17 - A method for detecting methylated CpGs involves...Ch. 17 - Honeybees Apis mellifera provide a striking...Ch. 17 - Consider the experiment in Fig. 17.24, where the...Ch. 17 - A protein or RNA that regulates gene expression in...Ch. 17 - a. How can a single eukaryotic gene give rise to...Ch. 17 - A hunchback gene, a gene necessary for proper...Ch. 17 - You know that the mRNA and protein produced by a...Ch. 17 - You are studying a transgenic mouse strain that...Ch. 17 - Prob. 35PCh. 17 - Scientists have exploited the siRNA pathway to...Ch. 17 - Persimmons Diospyros lotus are dioecious plants,...Ch. 17 - Drosophila females homozygous for loss-of-function...Ch. 17 - The text has discussed the RNA-Seq technique,...Ch. 17 - Researchers know that Fru-M controls male sexual...Ch. 17 - The Drosophila gene Sex lethal Sxl is deserving of...Ch. 17 - Figure 17.29 shows that the Sxl protein binds to...
Knowledge Booster
Similar questions
- The chart below is a position specific scoring matrix (PSSM, a logarithmic transformed matrix) for a transcription factor binding site. (1). Evaluate a sequence “GACATTCA” to find out which segment of the sequence fits the binding site best. (2) What is the max score that a sequence can have with this PSSM? (3) What is the minimum score a sequence can have with this PSSM?arrow_forwardThe transcription factor Pax6 is required continually during the life of a mouse (or a human) for the development of the retina. Homozygous Pax6 knockout mice die soon after birth because Pax6 protein is also required in essential organs, such as the pancreas. a) In order to study the role of Pax6 in eye development a researcher wants to generate a mouse that expresses Pax6 everywhere except in its eyes. Describe how you could construct such a mouse by floxing the gene. Is it possible to achieve the same end with a transgene? (Hint: think about using cDNA and RNAI) b) Suppose you want to create a mouse similar to that in part (a), but one where the eye cells from Pax6 function has been removed and now express a gene that specifies a green fluorescent protein (GFP). Marking the cells in this way will allow the investigators to see the shapes of the Pax6- eye cells more easily than if they did not express GFP. Diagram a Pax6 gene construct that would enable the researcher to do this…arrow_forwardWhich of the following statements is true regarding the lys2-128d reporter? Select all that apply. a.) Mutants that activate this reporter are likely to have mutations in PIC components. b.) This reporter is sensitive to changes in chromatin maintenance because the start site is located within the ORF. c.) Mutants that activate this reporter cause downstream shifts in transcription start site selection. d.) This reporter is being used to help us rule out mutations that are likely impacting chromatin structure.arrow_forward
- c) You use chromatin immunoprecipitation to measure the location and amount of transcription factors binding around the Lrg1 gene in the four treatments. You use your data to generate the following figure. Orient yourself to the figure by finding the transcription start site on the x-axis. The size of the peak indicates the frequency of the transcription factor at that position. Lrg1 Lrg1 transcription Control u = 12 2. 3 Sucrose = 77 Sucrose + = 180 Hormone 4 Starvation = 2 -2,000 bp -1,000 bp +1 bp +1,000 bp i) What type of transcription factor might be present at position 2? What evidence from the figure supports your claim? (two sentences max) What type of transcription factor might be present at position 3? What evidence ii) from the figure supports your claim? (two sentences max) iii) Look at the transcription factors at position 4. Use evidence from the figure to explain the effect they are having on transcription of Lrg1. (two sentences max)arrow_forwardYou have isolated different mutants (reg1 and reg2) causing constitutive expression of the emu operon (which has genes emu1 and emu2). One mutant contains a defect in a DNA-binding site, and the other has a loss-of-function defect in the gene encoding a protein that binds to the site. Is the DNA-binding protein a positive or negative regulator of gene expression?arrow_forwarda) The best vector to use determine receptor binding protein expression would have been one with a GFP gene (green flourescent protein) attached. State one (1) reason why including this gene would have made the experiment easier and whether you have inserted the receptor binding domain gene before or after the GFP gene. b) You wish to determine the sucess pf your transformation by detecting the presence of receptor binding domian mRNA. Describe the key steps of the hybrdization technique you would use, clearly stating how you would design the probe to detect your receptor mRNA.arrow_forward
- You have isolated two different mutants (reg1 and reg2) causing constitutive expression of the emu operon (emu1 emu2). One mutant contains a defect in a DNA-binding site, and the other has a loss-of-function defect in the gene encoding a protein that binds to the site. Is the DNA-binding protein a positive or negative regulator of gene expression? Explain. To determine which mutant has a defect in the site and which one has a mutation in the binding protein, you decide to do an analysis using F′ plasmids. Assuming you can assay levels of the Emu1 and Emu2 proteins, what results do you predict for the two strains (i and ii; see descriptions below) if reg2 encodes the regulatory protein and reg1 is the regulatory site? Explain. F′ (reg1− reg2+ emu1− emu2+)/reg1+ reg2+ emu1+ emu2− F′ (reg1+ reg2− emu1− emu2+)/reg1+ reg2+ emu1+ emu2−arrow_forwardGR and PPAR are transcription factors that bind to GRE and PPARE sequences respectively and activate transcription of genes. A reporter cell line is created in which the the green fluoresecent protein (GFP) is controlled by a GRE sequence and the pink fluorescent protein mCherry is under control of a PPARE sequence. If the gene for GR is introduced into the reporter cell line, the cells produce a green color. Chimeric proteins are created in which the DNA Binding Domains (DBD) and Activation Domains (AD) of the transcription factors are introduced into various cell lines. Match the following cell-types with the fluorescent color(s) you would expect the cells to produce.arrow_forward(a) Did deletion of any of the possible control elements cause areduction in reporter gene expression? If so, which one(s), and howcan you tell? (b) If loss of a control element causes a reduction ingene expression, what must be the normal role of that controlelement? Provide a biological explanation for how the loss of sucha control element could lead to a reduction in gene expression.arrow_forward
- In the laboratory, you want to study protein that is normally toxic to E. coli cells. You wish to grow this protein in E. coli and purify it from E. coli. Your advisor suggests cloning the gene into an expression vector that uses the araBAD promoter. Explain why is it ideal to use the araBAD promoter for expression of your gene of interest in E. coli cells?arrow_forwardYour investors are concerned that the GasP protein might not be sufficiently produced under normal laboratory conditions. They suggest controlling the transcription of the gasP gene using a chemical that will “trigger” its transcription. a. What type of promoter could be used? b. What chemical will you use to control transcription? c. How does this method of control work?arrow_forwardYou identify a fragment of DNA that, when fused to a GFP reporter, can express GFP in a mouse's eyes. You suspect some piece of that fragment represents a promoter and another piece represents an enhancer. You want to know which is which. What experiments do you perform to see which piece is a promoter and which is an enhancer? Hint: remember the important differences between promoters and enhancers. Then build constructs that test those differences.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education