ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
6th Edition
ISBN: 9781260406092
Author: HARTWELL, Leland, HOOD, Leroy, Goldberg, Michael
Publisher: Mcgraw-hill Education/stony Brook University
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 17, Problem 32P
A hunchback gene, a gene necessary for proper patterning of Drosophila embryo, is translationally regulated. The position of the coding region within the transcript is known. How could you determine the sequences within the 5' UTR or 3' UTR', or both, are necessary for the proper regulation of the mRNA's translation?
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
The hunchback gene, a gene necessary for proper patterning of the Drosophila embryo, is translationallyregulated. The position of the coding region withinthe transcript is known. How could you determine ifthe sequences within the 5′ UTR or 3′ UTR, or both,are necessary for proper regulation of the mRNA’stranslation?
In eukaryotes there is not a consistent relationship between the length of the coding sequence of a gene and the length of the mature mRNA it encodes, even though one nucleotide in DNA = one nucleotide in pre-mRNA or primary transcript. Explain why this is so.
Even though the lac Z, Y, and A structural genes are transcribed as a single polycistronic mRNA, each gene contains the initiation and termination signals essential for translation. Predict what will happen when a cell growing in the presence of lactose contains a deletion of one nucleotide (a) early in the Z gene and (b) early in the A gene.
Chapter 17 Solutions
ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
Ch. 17 - For each of the terms in the left column, choose...Ch. 17 - For each of the following types of gene...Ch. 17 - List five events other than transcription...Ch. 17 - Which eukaryotic RNA polymerase RNA pol I, pol II,...Ch. 17 - As shown in the following diagram, a single...Ch. 17 - You have synthesized an enhancerless GFP reporter...Ch. 17 - Prob. 7PCh. 17 - Prob. 8PCh. 17 - A single UAS regulates the expression of three...Ch. 17 - MyoD is a transcriptional activator that turns on...
Ch. 17 - a. Assume that two transcription factors are...Ch. 17 - Prob. 12PCh. 17 - In Problem 12, you identified a genomic region...Ch. 17 - Prob. 14PCh. 17 - Prob. 15PCh. 17 - Genes in both prokaryotes and eukaryotes are...Ch. 17 - Prob. 17PCh. 17 - Lysine 4 of histone H3 H3K4 is methylated in the...Ch. 17 - J.T. Lis and collaborators have developed an...Ch. 17 - Hydatiform moles are growths of undifferentiated...Ch. 17 - Prader-Willi syndrome is caused by a mutation in...Ch. 17 - The human IGF2 gene is autosomal and maternally...Ch. 17 - Follow the expression of a paternally imprinted...Ch. 17 - Reciprocal crosses were performed using two inbred...Ch. 17 - Interestingly, imprinting can be tissue-specific....Ch. 17 - Prob. 26PCh. 17 - A method for detecting methylated CpGs involves...Ch. 17 - Honeybees Apis mellifera provide a striking...Ch. 17 - Consider the experiment in Fig. 17.24, where the...Ch. 17 - A protein or RNA that regulates gene expression in...Ch. 17 - a. How can a single eukaryotic gene give rise to...Ch. 17 - A hunchback gene, a gene necessary for proper...Ch. 17 - You know that the mRNA and protein produced by a...Ch. 17 - You are studying a transgenic mouse strain that...Ch. 17 - Prob. 35PCh. 17 - Scientists have exploited the siRNA pathway to...Ch. 17 - Persimmons Diospyros lotus are dioecious plants,...Ch. 17 - Drosophila females homozygous for loss-of-function...Ch. 17 - The text has discussed the RNA-Seq technique,...Ch. 17 - Researchers know that Fru-M controls male sexual...Ch. 17 - The Drosophila gene Sex lethal Sxl is deserving of...Ch. 17 - Figure 17.29 shows that the Sxl protein binds to...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Transcriptional regulators are proteins that bind to promoters (the 5-flanking regions of genes) to regulate their transcription. Assume that a particular transcription regulator normally promotes transcription of gene X, a transport protein. If a mutation makes this regulator gene nonfunctional, would the resulting phenotype be similar to a mutation in gene X itself? Why or why not?arrow_forwardImagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow Fluorescent Protein (YFP). To generate the YFP, you know the pre-MRNA looks as follows: Unspliced YFP premature mRNA Сap 5' UTR Exon 1 Intron Exon 2 Intron Exon 3 3' UTR Poly-A tail If Exon 2 is also required for mRNA stability, what can be predicted from the possible spliced alternative isoforms formed? One of the isoforms will not have a poly-A tail O The alternative splicing of YFP pre-MRNA prevents 5'-capping The MRNA isoform without Exon 2 will be degraded faster than the other isoform Exon 2 will be added to isoform B later to correct the mistake in splicing The protein translated from one of the mRNA isoforms will possess an additional functional domainarrow_forwardGenes can be transcribed into mRNA, in the case of protein coding genes, or into RNA, in the case of genes such as those that encode ribosomal or transfer RNAs. Define a gene. For the following characteristics, state whether they apply to (a) continuous, (b) simple, or (c) complex transcription units.i. Found in eukaryotesii. Contain intronsiii. Capable of making only a single protein from a given genearrow_forward
- What proportion (in %) of the CFTR gene/DNA sequence is represented in the CFTR mRNA? The mRNA contains a 5’ UTR, ORF, and 3’ UTR. What proportion (in %) of the mRNA is represented in the ORF?arrow_forwardYou are teaching a class on the regulation of eukaryotic gene expression. In order to demonstrate this complex process, you decide to draw for the class a typical eukaryotic gene/transcription unit with its major regions, such as the promoter regions, where the RNA polymerase II and transcription factors would bind From the list given - choose all components that you think are part of a typical eukaryotic gene From the list given - choose all the regulatory sequences that you think would control the expression of this eukaryotic gene From the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to control its expressionarrow_forwardDraw the SMN2 pre-mRNA (10 exons and 9 introns), indicate the 5’ and 3’ SS location. Draw the SMN2 mature mRNA before treatment with Spinraza. What type of alternative splicing is occurring? Draw the SMN2 mature mRNA after treatment with Spinrazaarrow_forward
- The asterisk (*) in the diagram below indicates a single base mutation in the 5' splice site of the second intron of a eukaryotic gene. Due to this mutation, the second intron is now not ‘spliced out’ during the splicing process. What are the most likely consequences of this mutation with respect to the size of the pre-mRNA and the size of the mature mRNA? a. The pre-mRNA will be longer and the mature mRNA will be longer. b. The pre-mRNA will be longer and the size of the mature mRNA will not be affected c. The size of the pre-mRNA will not be affected and the mature mRNA will be longer d. The size of the pre-mRNA will not be affected and the size of the mature mRNA will not be affectedarrow_forward"Upstream" "Downstream" Exons Start of transcription Termination codon 5 3' Promoter initiator codon Introns Polyadenylation signal (intervening sequences) 5' untranslated region 3' untranslated region Direction of transcription Please study the diagram above on eukaryotic gene expression. In order to provide instructions for gene expression, a eukaryotic gene should have the following sequences except for O A. Promoter B. Start codon also known as initiator codon C. Splicing signals (dinucleotide sequence in the intron) O D. 5' CAP sequencearrow_forwardWhat is the mechanism for addition of a guanosine to create the 5' methyl cap of a mRNA? O The 5'-OH end of the nascent mRNA performs a nucleophilic attack on the gamma phosphate of GTP O The gamma phosphate is removed from the 3' end of the nascent MRNA and then the beta-phosphate attacks the phosphorus atom of the alpha- phosphate of GTP O The gamma phosphate is removed from the 5' end of the nascent mRNA and then the -OH group from the beta-phosphate attacks the phosphorus atom of the alpha- phosphate of GTP O The 5'-OH end of the beta phosphate present on nascent mRNA performs a nucleophilic attack on the alpha-phosphate of GTParrow_forward
- The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. What would be the base sequence of the mRNA transcribed from this gene? Highlight the start codon sequence State the amino acid sequence of the polypeptide translated from this mRNA Based on the information from part (a) and (b), describe the process used by eukaryotes to produce protein.arrow_forwardA common feature of many eukaryotic mRNAs is the presence of a rather long 3′ UTR, which often contains consensus sequences. Creatine kinase B (CK-B) is an important enzyme in cellular metabolism. Certain cells—termed U937D cells—have lots of CK-B mRNA, but no CK-B enzyme is present. In these cells, the 5′ end of the CK-B mRNA is bound to ribosomes, but the mRNA is apparently not translated. Something inhibits the translation of the CK-B mRNA in these cells. Researchers introduced numerous short segments of RNA containing only 3′ UTR sequences into U937D cells. As a result, the U937D cells began to synthesize the CK-B enzyme, but the total amount of CK-B mRNA did not increase. The introduction of short segments of other RNA sequences did not stimulate the synthesis of CK-B; only the 3′ UTR sequences turned on the translation of the enzyme. On the basis of these results, propose a mechanism for the inhibition of CK-B translation in the U937D cells. Explain how the introduction of short…arrow_forwardDefine both transcription and translation. In addition, describe the role(s) of each of the following in the processes of gene expression and protein synthesis: DNA, mRNA, tRNA, rRNA, ribosome(s), RNA polymerase, codon, anticodon, amino acid(s) and polypeptide(s). Be detailed in your answer.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license