Biological Science (7th Edition)
7th Edition
ISBN: 9780134678320
Author: Scott Freeman, Kim Quillin, Lizabeth Allison, Michael Black, Greg Podgorski, Emily Taylor, Jeff Carmichael
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 17, Problem 5TYU
RNases and proteases are enzymes that destroy RNAs and proteins, respectively. Which of the following enzymes when added to a spliceosome is predicted to prevent recognition of pre-mRNA regions critical for splicing?
a. an RNase specific for tRNAs
b. an RNase specific for snRNAs
c. a protease specific for initiation factors
d. a protease specific for a release factor
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Why might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic mRNA?
a. If the mutation occurs in the 5' end of the start site, it will not affect the gene product.
b. If the mutation occurs in the exon, it will not affect the gene product.
c. If the mutation occurs in the splice site of a transcript with alternative splicing, only one gene product may
affected.
O d. If the mutation occurs in the intron or not in the splice site of a transcript with alternative splicing, it will nc
affect the gene product.
O e. If the mutation occurs in the 3' end of the start site, it will not affect the gene product.
OLIE STIC N 1A
Define the following terms: a. promoter b. consensus sequence c. operon d. chromatin-remodeling complex e. general transcription factors
During the processing of pre-mRNA in eukaryotes
Select one:
a. Exons are joined together using polyadenylate polymerase
b. The spliceosome breaks covalent bonds at 5' and 3' splice sites
c. A 5'methyl cytosine cap is added using specific enzyme
d. A 3'-poly-A tail is attached using an unusual 5'-5 ester linkage
Chapter 17 Solutions
Biological Science (7th Edition)
Ch. 17 - Prob. 1TYKCh. 17 - Prob. 3TYKCh. 17 - Prob. 4TYKCh. 17 - 5. RNases and proteases are enzymes that destroy...Ch. 17 - Prob. 6TYUCh. 17 - The nucleotide shown below is called cordycepin...Ch. 17 - Prob. 10TYPSSCh. 17 - What better not be for dinner? Eating even a...Ch. 17 - 12. α-Amanitin inhibits transcription by binding...Ch. 17 - Prob. 13PIAT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Explain how each of the following processes complicates the concept of colinearity. a. Trans-splicing b. Alternative splicing c. RNA editingarrow_forwardWhich of the following snRNPs facilitate the second transesterification reaction during mRNA splicing? a. U6 b. U5 c. U4 d. U3arrow_forwardChoose the item in column 2 that best matches each item in column 1. A. Provides information for production of protein B. Binds to promoter C. Promoter has a box A and box B consensus sequences D. Autocatalytic RNA molecules E. Associated with transcription termination F. Polymerization of ribonucleotides to form RNA molecules G. 7-methyl guanosine H. MRNA prior to processing select - 1. Core RNA polymerase select 2. rho (p) factor select 3. hnRNA select - 4. RNA select -5. RNA polymerase holoenzyme select 6. Ribozymes select - 7. 5' MRNA cap select 8. MRNAarrow_forward
- The asterisk (*) in the diagram below indicates a single base mutation in the 5' splice site of the second intron of a eukaryotic gene. Due to this mutation, the second intron is now not ‘spliced out’ during the splicing process. What are the most likely consequences of this mutation with respect to the size of the pre-mRNA and the size of the mature mRNA? a. The pre-mRNA will be longer and the mature mRNA will be longer. b. The pre-mRNA will be longer and the size of the mature mRNA will not be affected c. The size of the pre-mRNA will not be affected and the mature mRNA will be longer d. The size of the pre-mRNA will not be affected and the size of the mature mRNA will not be affectedarrow_forwardWhich of the following about the splicing in posttranscriptional processing is NOT true? a. In bacterial, the genes coding for polypeptides are interrupted by non-coding regions. O b. O C. O d. Introns in eukaryotic hnRNA must be cut out before mature mRNA can be used for protein synthesis. Alternate splicing can lead to tissue-specific proteins. Splicing can lead to multi-domain proteins.arrow_forwardArrange the statements in their proper order by writing the corresponding letter (e.g. A) for each statement in the space provided below. A. The single-stranded RNA would complement the target RNA. B. Gene expression is inactivated once the mRNA is no longer accessible for translation. C. The risk-induced silencing complex which is composed of RNA and protein subunits is formed. D. Double-stranded, non-coding RNA is cleaved by Dicer. E. The mRNA can be cleaved or remain bound by the RISC. 1. 2. 3. 4. 5.arrow_forward
- The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.arrow_forwardWhich of the following statements about pre-mRNA splicing is FALSE? a. Splicing of an intron requires consensus sequences at the splice donor, the splice acceptor and the branch point of the intron. b. The spliceosome contains proteins and RNA molecules. c. Some snRNAs base pair with splice consensus sequences on the primary transcript. d. Splicing happens before the export of the mRNA to the cytoplasm. e. Splicing happens in the cytoplasm, when spliceosomes move down the pre-mRNA in front of ribosomes.arrow_forwardA principle function of 5' and 3' end modifications of eukaryotic mRNA is: a. to ensure that all nucleotides are phosphorylated b. to protect RNA from nucleolytic degradation c. to guide the removal of introns d. to serve as binding sites for translation release factorsarrow_forward
- Define and describe the roles of the following in transcription: a. transcription factors b. RNA polymerase c. promoter d. sigma factor e. enhancer f. TATA boxarrow_forwardGiven is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?arrow_forwardWhat are two reasons that a eukaryotic gene (e.g. Green Fluorescent Protein in jellyfish) will not be expressed if it is inserted into a bacterial genome with no alterations? a. Bacterial genes do not contain introns b. Bacterial promoters have different consensus sequences than eukaryotic ones c. Transcription of this gene is affected by the simultaneous processes of transcription and translation d.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY